Multiple sequence alignment - TraesCS7D01G503500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G503500 chr7D 100.000 3203 0 0 1 3203 608535937 608532735 0.000000e+00 5915
1 TraesCS7D01G503500 chr7D 97.988 3131 33 12 75 3203 607599054 607595952 0.000000e+00 5406
2 TraesCS7D01G503500 chr7D 79.563 1145 195 24 1002 2126 608513984 608512859 0.000000e+00 782
3 TraesCS7D01G503500 chr7D 74.253 1573 292 64 1032 2554 514758678 514757169 1.000000e-154 556
4 TraesCS7D01G503500 chr7D 76.770 1102 141 55 2164 3203 608500732 608499684 7.930000e-141 510
5 TraesCS7D01G503500 chrUn 89.553 3264 251 43 3 3203 83387822 83384586 0.000000e+00 4056
6 TraesCS7D01G503500 chrUn 79.327 416 75 10 1023 1431 77772842 77773253 6.760000e-72 281
7 TraesCS7D01G503500 chrUn 100.000 40 0 0 821 860 83386935 83386896 1.230000e-09 75
8 TraesCS7D01G503500 chr7B 91.207 1649 96 14 1417 3030 696832187 696830553 0.000000e+00 2196
9 TraesCS7D01G503500 chr7B 90.239 543 50 1 870 1412 696841043 696840504 0.000000e+00 706
10 TraesCS7D01G503500 chr7B 84.568 648 64 15 3 642 696848682 696848063 7.600000e-171 610
11 TraesCS7D01G503500 chr7B 80.430 419 70 10 1020 1432 697422840 697423252 3.100000e-80 309
12 TraesCS7D01G503500 chr7B 79.762 420 71 12 1020 1432 685048569 685048981 3.130000e-75 292
13 TraesCS7D01G503500 chr7B 88.321 137 8 1 727 855 696841308 696841172 1.190000e-34 158
14 TraesCS7D01G503500 chr7B 77.778 198 26 8 2416 2601 685240066 685239875 4.370000e-19 106
15 TraesCS7D01G503500 chr7A 78.544 769 139 16 1276 2031 699790640 699789885 1.730000e-132 483
16 TraesCS7D01G503500 chr7A 80.098 407 69 11 1031 1431 700160733 700160333 3.130000e-75 292
17 TraesCS7D01G503500 chr7A 78.082 438 89 7 1031 1464 700074306 700073872 1.460000e-68 270
18 TraesCS7D01G503500 chr7A 78.072 415 79 9 1020 1432 700091889 700091485 5.300000e-63 252


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G503500 chr7D 608532735 608535937 3202 True 5915.0 5915 100.0000 1 3203 1 chr7D.!!$R5 3202
1 TraesCS7D01G503500 chr7D 607595952 607599054 3102 True 5406.0 5406 97.9880 75 3203 1 chr7D.!!$R2 3128
2 TraesCS7D01G503500 chr7D 608512859 608513984 1125 True 782.0 782 79.5630 1002 2126 1 chr7D.!!$R4 1124
3 TraesCS7D01G503500 chr7D 514757169 514758678 1509 True 556.0 556 74.2530 1032 2554 1 chr7D.!!$R1 1522
4 TraesCS7D01G503500 chr7D 608499684 608500732 1048 True 510.0 510 76.7700 2164 3203 1 chr7D.!!$R3 1039
5 TraesCS7D01G503500 chrUn 83384586 83387822 3236 True 2065.5 4056 94.7765 3 3203 2 chrUn.!!$R1 3200
6 TraesCS7D01G503500 chr7B 696830553 696832187 1634 True 2196.0 2196 91.2070 1417 3030 1 chr7B.!!$R2 1613
7 TraesCS7D01G503500 chr7B 696848063 696848682 619 True 610.0 610 84.5680 3 642 1 chr7B.!!$R3 639
8 TraesCS7D01G503500 chr7B 696840504 696841308 804 True 432.0 706 89.2800 727 1412 2 chr7B.!!$R4 685
9 TraesCS7D01G503500 chr7A 699789885 699790640 755 True 483.0 483 78.5440 1276 2031 1 chr7A.!!$R1 755

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
314 324 1.151677 TACTTGCCCTCCCCACCTT 60.152 57.895 0.0 0.0 0.00 3.50 F
863 950 2.027745 TCAACTGAACTCCAGCAGATCC 60.028 50.000 0.0 0.0 46.81 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1458 1665 0.865769 CCTTGACCGAGTTTTCCACG 59.134 55.0 0.0 0.0 0.0 4.94 R
2749 3053 2.579410 AAAAACAGTGTCCCGCCTAT 57.421 45.0 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 2.032634 GCCGTCCGTGCATTTGAGA 61.033 57.895 0.00 0.00 0.00 3.27
41 42 2.817258 CCGTGCATTTGAGAAGGGTTTA 59.183 45.455 0.00 0.00 0.00 2.01
69 70 2.287069 CCGACCGTAGATGCTCTTACAG 60.287 54.545 0.00 0.00 0.00 2.74
72 73 4.261238 CGACCGTAGATGCTCTTACAGAAT 60.261 45.833 0.00 0.00 0.00 2.40
105 115 8.299570 CCTATTTCAGCGGCATAAGAAAATTAT 58.700 33.333 1.45 0.00 34.13 1.28
314 324 1.151677 TACTTGCCCTCCCCACCTT 60.152 57.895 0.00 0.00 0.00 3.50
484 496 2.978978 TCCAACCAGAGATCTTTGTCCA 59.021 45.455 11.96 0.00 0.00 4.02
766 800 2.137523 GCTGTCCAAATTGGCACTTTG 58.862 47.619 19.88 19.88 37.47 2.77
863 950 2.027745 TCAACTGAACTCCAGCAGATCC 60.028 50.000 0.00 0.00 46.81 3.36
1458 1665 1.476471 CCTGAAGATCTGGTGGCATCC 60.476 57.143 0.00 0.00 31.65 3.51
1539 1761 3.470709 CAACAAGGCTGAAGAGACTGAA 58.529 45.455 0.00 0.00 36.02 3.02
2746 3050 9.982651 GCCTCACAACATCCGTTATATATATAT 57.017 33.333 10.10 10.10 32.75 0.86
2767 3071 3.926058 ATATAGGCGGGACACTGTTTT 57.074 42.857 0.00 0.00 0.00 2.43
3013 3329 2.357034 AGTACGCCAGCAACCACG 60.357 61.111 0.00 0.00 0.00 4.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 4.468689 GGCCGGCCTGGTCACTAC 62.469 72.222 38.76 7.31 44.04 2.73
33 34 4.419921 CGGGCGCCCTAAACCCTT 62.420 66.667 41.01 0.00 41.86 3.95
69 70 2.219674 CGCTGAAATAGGCGTCAGATTC 59.780 50.000 12.62 0.00 43.32 2.52
72 73 3.345737 CGCTGAAATAGGCGTCAGA 57.654 52.632 12.62 0.00 43.32 3.27
314 324 0.474854 TTCCCTGTCAGCCCCAAGTA 60.475 55.000 0.00 0.00 0.00 2.24
999 1197 2.087646 GTTTTCTGGCTGGTCTCCATC 58.912 52.381 0.00 0.00 30.82 3.51
1458 1665 0.865769 CCTTGACCGAGTTTTCCACG 59.134 55.000 0.00 0.00 0.00 4.94
2746 3050 5.362105 AAAAACAGTGTCCCGCCTATATA 57.638 39.130 0.00 0.00 0.00 0.86
2747 3051 3.926058 AAAACAGTGTCCCGCCTATAT 57.074 42.857 0.00 0.00 0.00 0.86
2748 3052 3.706600 AAAAACAGTGTCCCGCCTATA 57.293 42.857 0.00 0.00 0.00 1.31
2749 3053 2.579410 AAAAACAGTGTCCCGCCTAT 57.421 45.000 0.00 0.00 0.00 2.57
3013 3329 3.307242 CGTTGCTGGAGTTATTGCTAGTC 59.693 47.826 0.00 0.00 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.