Multiple sequence alignment - TraesCS7D01G493300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G493300 chr7D 100.000 3188 0 0 1 3188 601440640 601437453 0.000000e+00 5888.0
1 TraesCS7D01G493300 chr7D 98.828 2304 23 2 885 3188 601410906 601408607 0.000000e+00 4102.0
2 TraesCS7D01G493300 chr7D 81.329 1821 273 38 741 2540 601463848 601462074 0.000000e+00 1417.0
3 TraesCS7D01G493300 chr7D 81.329 1671 254 25 730 2381 601494615 601492984 0.000000e+00 1304.0
4 TraesCS7D01G493300 chr7D 83.229 477 40 6 146 590 601494994 601494526 4.950000e-108 401.0
5 TraesCS7D01G493300 chr7D 73.899 954 212 28 1352 2291 553516140 553515210 6.550000e-92 348.0
6 TraesCS7D01G493300 chr7D 79.197 274 19 12 166 402 601464247 601463975 4.260000e-34 156.0
7 TraesCS7D01G493300 chr7D 95.506 89 3 1 1 88 601411619 601411531 1.190000e-29 141.0
8 TraesCS7D01G493300 chr7D 80.597 134 14 6 2258 2381 601490603 601490472 3.390000e-15 93.5
9 TraesCS7D01G493300 chr7A 95.590 2812 63 25 1 2759 693198910 693196107 0.000000e+00 4449.0
10 TraesCS7D01G493300 chr7A 98.232 396 7 0 2793 3188 693196108 693195713 0.000000e+00 693.0
11 TraesCS7D01G493300 chr7B 81.563 1676 269 25 730 2381 680541962 680540303 0.000000e+00 1347.0
12 TraesCS7D01G493300 chr7B 81.229 586 53 28 166 696 680542328 680541745 1.370000e-113 420.0
13 TraesCS7D01G493300 chr7B 74.681 861 194 20 1421 2274 599872482 599871639 8.410000e-96 361.0
14 TraesCS7D01G493300 chr1B 78.244 1310 248 30 953 2249 560020323 560019038 0.000000e+00 806.0
15 TraesCS7D01G493300 chr2D 74.915 881 191 25 1421 2291 32158256 32157396 3.000000e-100 375.0
16 TraesCS7D01G493300 chr5D 86.792 53 7 0 1352 1404 399928460 399928512 3.430000e-05 60.2
17 TraesCS7D01G493300 chr5B 86.792 53 7 0 1352 1404 479816489 479816541 3.430000e-05 60.2
18 TraesCS7D01G493300 chr2A 87.755 49 6 0 1355 1403 47779508 47779460 1.240000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G493300 chr7D 601437453 601440640 3187 True 5888.0 5888 100.000000 1 3188 1 chr7D.!!$R2 3187
1 TraesCS7D01G493300 chr7D 601408607 601411619 3012 True 2121.5 4102 97.167000 1 3188 2 chr7D.!!$R3 3187
2 TraesCS7D01G493300 chr7D 601462074 601464247 2173 True 786.5 1417 80.263000 166 2540 2 chr7D.!!$R4 2374
3 TraesCS7D01G493300 chr7D 601490472 601494994 4522 True 599.5 1304 81.718333 146 2381 3 chr7D.!!$R5 2235
4 TraesCS7D01G493300 chr7D 553515210 553516140 930 True 348.0 348 73.899000 1352 2291 1 chr7D.!!$R1 939
5 TraesCS7D01G493300 chr7A 693195713 693198910 3197 True 2571.0 4449 96.911000 1 3188 2 chr7A.!!$R1 3187
6 TraesCS7D01G493300 chr7B 680540303 680542328 2025 True 883.5 1347 81.396000 166 2381 2 chr7B.!!$R2 2215
7 TraesCS7D01G493300 chr7B 599871639 599872482 843 True 361.0 361 74.681000 1421 2274 1 chr7B.!!$R1 853
8 TraesCS7D01G493300 chr1B 560019038 560020323 1285 True 806.0 806 78.244000 953 2249 1 chr1B.!!$R1 1296
9 TraesCS7D01G493300 chr2D 32157396 32158256 860 True 375.0 375 74.915000 1421 2291 1 chr2D.!!$R1 870

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
144 146 1.202031 GCCGCCGTTCAAACAATAGAG 60.202 52.381 0.0 0.0 0.0 2.43 F
1478 1634 0.116143 AGGGTGCTCTGGTTCTCTCT 59.884 55.000 0.0 0.0 0.0 3.10 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2110 2277 0.734309 TGAGCAAGCCGCATACAATG 59.266 50.000 0.0 0.0 46.13 2.82 R
2644 2864 6.961554 GCACTAAGTTTAATTCTCCAATCACG 59.038 38.462 0.0 0.0 0.00 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 1.752436 GCTCGGAATGGGAGAGAGAGA 60.752 57.143 0.00 0.00 34.13 3.10
144 146 1.202031 GCCGCCGTTCAAACAATAGAG 60.202 52.381 0.00 0.00 0.00 2.43
179 181 4.142038 GAGTCAATCTCCTCCCTCTCTAC 58.858 52.174 0.00 0.00 37.22 2.59
181 183 2.778270 TCAATCTCCTCCCTCTCTACGA 59.222 50.000 0.00 0.00 0.00 3.43
202 204 2.310413 AAATTCCCCATCCCTCTCCT 57.690 50.000 0.00 0.00 0.00 3.69
451 531 3.670377 GCTTCGCCGCCCAAACTT 61.670 61.111 0.00 0.00 0.00 2.66
522 604 1.594034 GCAGATTGCGCTGAAATCTCG 60.594 52.381 16.18 13.14 41.39 4.04
722 862 8.463930 TTTTCAGTTGACCTTTTGTCTGATAT 57.536 30.769 0.00 0.00 44.75 1.63
737 877 6.286758 TGTCTGATATTTTCTCCTGCAGATC 58.713 40.000 17.39 8.05 34.00 2.75
758 898 5.330455 TCGAGCTCAAATCTCACTTGTAT 57.670 39.130 15.40 0.00 0.00 2.29
806 946 2.438954 CGCTGCCGATTTTGCTTGC 61.439 57.895 0.00 0.00 36.29 4.01
807 947 2.096442 GCTGCCGATTTTGCTTGCC 61.096 57.895 0.00 0.00 0.00 4.52
1478 1634 0.116143 AGGGTGCTCTGGTTCTCTCT 59.884 55.000 0.00 0.00 0.00 3.10
1590 1747 2.985896 TCGCCTTCTGTGGAAAATAGG 58.014 47.619 0.00 0.00 0.00 2.57
1703 1861 1.943046 CACAGGAGGATGTGCAGACAC 60.943 57.143 0.00 0.00 43.69 3.67
2109 2276 9.203421 GGTTTGGTTAAAATTGGTAAGAATCAG 57.797 33.333 0.00 0.00 0.00 2.90
2110 2277 8.708742 GTTTGGTTAAAATTGGTAAGAATCAGC 58.291 33.333 0.00 0.00 0.00 4.26
2111 2278 7.531857 TGGTTAAAATTGGTAAGAATCAGCA 57.468 32.000 0.00 0.00 0.00 4.41
2644 2864 2.131183 GACTGTCACTTCAGTGCTGTC 58.869 52.381 17.18 17.18 46.81 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 2.166254 CAGCAACCAACTTGAAACACCT 59.834 45.455 0.00 0.0 30.42 4.00
179 181 2.952310 GAGAGGGATGGGGAATTTTTCG 59.048 50.000 0.00 0.0 0.00 3.46
181 183 2.935887 AGGAGAGGGATGGGGAATTTTT 59.064 45.455 0.00 0.0 0.00 1.94
202 204 7.066781 AGTGAGGAAAAATTAGGTCTTCCAAA 58.933 34.615 2.78 0.0 39.91 3.28
251 273 0.598680 CCTCGATCTGGAATCCACGC 60.599 60.000 0.00 0.0 0.00 5.34
451 531 0.395311 AAGAGATAGGGACGGCGACA 60.395 55.000 16.62 0.0 0.00 4.35
522 604 2.412847 GCCTGTTGACACGAATACAAGC 60.413 50.000 0.00 0.0 0.00 4.01
722 862 1.552337 AGCTCGATCTGCAGGAGAAAA 59.448 47.619 19.10 0.0 33.12 2.29
737 877 6.128445 ACAAATACAAGTGAGATTTGAGCTCG 60.128 38.462 20.32 0.0 41.16 5.03
758 898 0.320374 CCCTCGCCTGTAGACACAAA 59.680 55.000 0.00 0.0 33.22 2.83
1590 1747 6.446318 TGAAAAGTGCACCTCATTCATTAAC 58.554 36.000 14.63 0.0 29.07 2.01
2110 2277 0.734309 TGAGCAAGCCGCATACAATG 59.266 50.000 0.00 0.0 46.13 2.82
2111 2278 1.683943 ATGAGCAAGCCGCATACAAT 58.316 45.000 0.00 0.0 46.13 2.71
2644 2864 6.961554 GCACTAAGTTTAATTCTCCAATCACG 59.038 38.462 0.00 0.0 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.