Multiple sequence alignment - TraesCS7D01G492900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G492900 chr7D 100.000 1692 0 0 837 2528 601305669 601303978 0.000000e+00 3125
1 TraesCS7D01G492900 chr7D 100.000 556 0 0 1 556 601306505 601305950 0.000000e+00 1027
2 TraesCS7D01G492900 chr7D 99.459 555 3 0 2 556 382014635 382014081 0.000000e+00 1009
3 TraesCS7D01G492900 chr2D 98.465 1694 23 2 837 2528 635038095 635039787 0.000000e+00 2981
4 TraesCS7D01G492900 chr2D 98.228 1693 28 2 837 2528 17966351 17964660 0.000000e+00 2959
5 TraesCS7D01G492900 chr7A 98.404 1692 25 2 837 2528 120828013 120826324 0.000000e+00 2974
6 TraesCS7D01G492900 chr7A 98.921 556 6 0 1 556 672005388 672005943 0.000000e+00 994
7 TraesCS7D01G492900 chr5B 98.345 1692 26 2 837 2528 713045374 713043685 0.000000e+00 2968
8 TraesCS7D01G492900 chr7B 98.288 1694 26 3 837 2528 743067142 743068834 0.000000e+00 2964
9 TraesCS7D01G492900 chr7B 98.921 556 6 0 1 556 743066540 743067095 0.000000e+00 994
10 TraesCS7D01G492900 chr5A 98.288 1694 26 3 837 2528 16622436 16620744 0.000000e+00 2964
11 TraesCS7D01G492900 chr5A 98.921 556 6 0 1 556 300048800 300049355 0.000000e+00 994
12 TraesCS7D01G492900 chr3D 98.229 1694 27 3 837 2528 202612781 202614473 0.000000e+00 2959
13 TraesCS7D01G492900 chr2A 98.284 1690 27 2 837 2525 735173637 735175325 0.000000e+00 2959
14 TraesCS7D01G492900 chr2A 99.101 556 5 0 1 556 735173034 735173589 0.000000e+00 1000
15 TraesCS7D01G492900 chr3B 98.227 1692 28 2 837 2528 201634968 201633279 0.000000e+00 2957
16 TraesCS7D01G492900 chrUn 99.281 556 4 0 1 556 273239032 273239587 0.000000e+00 1005
17 TraesCS7D01G492900 chr4D 99.101 556 5 0 1 556 123367876 123368431 0.000000e+00 1000
18 TraesCS7D01G492900 chr4D 98.921 556 6 0 1 556 123578827 123579382 0.000000e+00 994
19 TraesCS7D01G492900 chr1B 98.741 556 7 0 1 556 53339439 53338884 0.000000e+00 989
20 TraesCS7D01G492900 chr1B 97.059 68 2 0 989 1056 599338186 599338253 5.710000e-22 115


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G492900 chr7D 601303978 601306505 2527 True 2076.0 3125 100.0000 1 2528 2 chr7D.!!$R2 2527
1 TraesCS7D01G492900 chr7D 382014081 382014635 554 True 1009.0 1009 99.4590 2 556 1 chr7D.!!$R1 554
2 TraesCS7D01G492900 chr2D 635038095 635039787 1692 False 2981.0 2981 98.4650 837 2528 1 chr2D.!!$F1 1691
3 TraesCS7D01G492900 chr2D 17964660 17966351 1691 True 2959.0 2959 98.2280 837 2528 1 chr2D.!!$R1 1691
4 TraesCS7D01G492900 chr7A 120826324 120828013 1689 True 2974.0 2974 98.4040 837 2528 1 chr7A.!!$R1 1691
5 TraesCS7D01G492900 chr7A 672005388 672005943 555 False 994.0 994 98.9210 1 556 1 chr7A.!!$F1 555
6 TraesCS7D01G492900 chr5B 713043685 713045374 1689 True 2968.0 2968 98.3450 837 2528 1 chr5B.!!$R1 1691
7 TraesCS7D01G492900 chr7B 743066540 743068834 2294 False 1979.0 2964 98.6045 1 2528 2 chr7B.!!$F1 2527
8 TraesCS7D01G492900 chr5A 16620744 16622436 1692 True 2964.0 2964 98.2880 837 2528 1 chr5A.!!$R1 1691
9 TraesCS7D01G492900 chr5A 300048800 300049355 555 False 994.0 994 98.9210 1 556 1 chr5A.!!$F1 555
10 TraesCS7D01G492900 chr3D 202612781 202614473 1692 False 2959.0 2959 98.2290 837 2528 1 chr3D.!!$F1 1691
11 TraesCS7D01G492900 chr2A 735173034 735175325 2291 False 1979.5 2959 98.6925 1 2525 2 chr2A.!!$F1 2524
12 TraesCS7D01G492900 chr3B 201633279 201634968 1689 True 2957.0 2957 98.2270 837 2528 1 chr3B.!!$R1 1691
13 TraesCS7D01G492900 chrUn 273239032 273239587 555 False 1005.0 1005 99.2810 1 556 1 chrUn.!!$F1 555
14 TraesCS7D01G492900 chr4D 123367876 123368431 555 False 1000.0 1000 99.1010 1 556 1 chr4D.!!$F1 555
15 TraesCS7D01G492900 chr4D 123578827 123579382 555 False 994.0 994 98.9210 1 556 1 chr4D.!!$F2 555
16 TraesCS7D01G492900 chr1B 53338884 53339439 555 True 989.0 989 98.7410 1 556 1 chr1B.!!$R1 555

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
880 881 0.175073 GCACCTAACCCACCTACTCG 59.825 60.0 0.0 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2218 2228 0.389948 CGTCGTTTAGGCCTGCTTCT 60.39 55.0 17.99 0.0 0.0 2.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 2.867109 CCGATTGGGCCTTCAGATAT 57.133 50.000 4.53 0.00 0.00 1.63
294 295 2.160417 CCGGTCTTTCATGCAAGAGTTC 59.840 50.000 8.12 0.00 33.29 3.01
880 881 0.175073 GCACCTAACCCACCTACTCG 59.825 60.000 0.00 0.00 0.00 4.18
899 900 3.331150 TCGCTCATCAATTACGGTGTTT 58.669 40.909 0.00 0.00 0.00 2.83
1176 1177 3.371595 CCCCTGTTCCTCGGATACAATTT 60.372 47.826 0.00 0.00 0.00 1.82
1194 1195 2.691409 TTGATCCTTCTACGGCCAAG 57.309 50.000 2.24 0.00 0.00 3.61
1452 1453 0.671251 TTTCCGAAAGCGTGCCAATT 59.329 45.000 0.00 0.00 35.23 2.32
1870 1873 9.027202 GGATAAAAATAAAGGAAACTGTACCCA 57.973 33.333 0.00 0.00 42.68 4.51
1903 1906 2.484264 ACGTAAACTCGTAAGCTACCGT 59.516 45.455 5.04 0.00 42.35 4.83
1971 1980 0.036732 CTGCAGGCAGGTTAGTTCCA 59.963 55.000 13.39 0.00 40.17 3.53
1983 1992 0.753867 TAGTTCCACTGTCGTTGCCA 59.246 50.000 0.00 0.00 0.00 4.92
2082 2092 7.946858 ATTCCGAAGAAAGACTGTTGGCAGT 62.947 44.000 0.00 0.00 46.15 4.40
2149 2159 0.614979 TAGAGCTCGGCAGAGGGTTT 60.615 55.000 15.89 0.74 44.51 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 3.515502 AGATAAGCCTGTAGTTGAGCACA 59.484 43.478 0.00 0.00 0.00 4.57
294 295 1.063469 CGTAGTAGCGGCCAAAAATGG 59.937 52.381 2.24 0.00 0.00 3.16
880 881 4.332819 AGCTAAACACCGTAATTGATGAGC 59.667 41.667 0.00 0.00 0.00 4.26
899 900 3.393800 GTCTTTCTGTGCAAGTCAGCTA 58.606 45.455 0.00 0.00 34.99 3.32
1176 1177 1.480954 GACTTGGCCGTAGAAGGATCA 59.519 52.381 11.35 0.00 0.00 2.92
1194 1195 4.550422 GAAGGCTTTCCACAAATTGAGAC 58.450 43.478 0.00 0.00 33.74 3.36
1452 1453 0.108186 CAGCTCCGCACAACATAGGA 60.108 55.000 0.00 0.00 0.00 2.94
1662 1663 0.033796 CCCACTACTCGGAGTACCCA 60.034 60.000 13.70 0.00 34.14 4.51
1814 1817 1.363145 TTACCCGAATTCGCGCAAGG 61.363 55.000 22.36 18.62 38.18 3.61
1870 1873 1.982958 AGTTTACGTCCATCCCTGGTT 59.017 47.619 0.00 0.00 43.61 3.67
1903 1906 2.605257 CTGGACGATTATCCCTACCCA 58.395 52.381 0.00 0.00 38.06 4.51
1971 1980 0.753262 AACTCTCTGGCAACGACAGT 59.247 50.000 0.00 0.00 40.10 3.55
1983 1992 2.230266 GTCTCTTCGCCAAGAACTCTCT 59.770 50.000 0.00 0.00 38.23 3.10
2082 2092 3.561313 GGCCAAAGAAATGTCTCCACCTA 60.561 47.826 0.00 0.00 30.70 3.08
2218 2228 0.389948 CGTCGTTTAGGCCTGCTTCT 60.390 55.000 17.99 0.00 0.00 2.85
2254 2264 1.332180 CGAACAATGCTGCTTGCGTG 61.332 55.000 0.00 2.10 46.63 5.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.