Multiple sequence alignment - TraesCS7D01G478300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G478300 chr7D 100.000 2351 0 0 1 2351 589251033 589248683 0 4342
1 TraesCS7D01G478300 chr7D 95.776 1681 70 1 1 1681 16646481 16644802 0 2710
2 TraesCS7D01G478300 chr7D 94.792 672 33 1 1682 2351 276486663 276485992 0 1046
3 TraesCS7D01G478300 chr2D 96.376 1683 60 1 1 1682 593126539 593128221 0 2769
4 TraesCS7D01G478300 chr2D 96.038 1691 61 5 1 1687 305961103 305959415 0 2747
5 TraesCS7D01G478300 chr2D 95.719 1682 66 4 1 1681 157031792 157033468 0 2702
6 TraesCS7D01G478300 chrUn 96.193 1681 64 0 1 1681 241760751 241759071 0 2750
7 TraesCS7D01G478300 chr5D 96.021 1684 60 6 1 1681 225859155 225860834 0 2732
8 TraesCS7D01G478300 chr5D 95.838 1682 69 1 1 1681 54749559 54751240 0 2717
9 TraesCS7D01G478300 chr5D 95.089 672 31 2 1682 2351 556674747 556675418 0 1057
10 TraesCS7D01G478300 chr3D 95.967 1686 61 3 1 1685 234618662 234620341 0 2730
11 TraesCS7D01G478300 chr3D 94.792 672 33 1 1682 2351 134621896 134621225 0 1046
12 TraesCS7D01G478300 chr4D 95.781 1683 69 2 1 1682 441127901 441129582 0 2713
13 TraesCS7D01G478300 chr4D 95.387 672 29 1 1682 2351 365661874 365661203 0 1068
14 TraesCS7D01G478300 chr4D 94.807 674 33 1 1680 2351 130646208 130646881 0 1050
15 TraesCS7D01G478300 chr1D 95.238 672 28 3 1682 2351 449904269 449903600 0 1061
16 TraesCS7D01G478300 chr1D 94.925 670 33 1 1682 2351 64367968 64368636 0 1048
17 TraesCS7D01G478300 chr1D 94.643 672 34 1 1682 2351 269941363 269942034 0 1040
18 TraesCS7D01G478300 chr6D 95.089 672 31 1 1682 2351 115309766 115310437 0 1057


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G478300 chr7D 589248683 589251033 2350 True 4342 4342 100.000 1 2351 1 chr7D.!!$R3 2350
1 TraesCS7D01G478300 chr7D 16644802 16646481 1679 True 2710 2710 95.776 1 1681 1 chr7D.!!$R1 1680
2 TraesCS7D01G478300 chr7D 276485992 276486663 671 True 1046 1046 94.792 1682 2351 1 chr7D.!!$R2 669
3 TraesCS7D01G478300 chr2D 593126539 593128221 1682 False 2769 2769 96.376 1 1682 1 chr2D.!!$F2 1681
4 TraesCS7D01G478300 chr2D 305959415 305961103 1688 True 2747 2747 96.038 1 1687 1 chr2D.!!$R1 1686
5 TraesCS7D01G478300 chr2D 157031792 157033468 1676 False 2702 2702 95.719 1 1681 1 chr2D.!!$F1 1680
6 TraesCS7D01G478300 chrUn 241759071 241760751 1680 True 2750 2750 96.193 1 1681 1 chrUn.!!$R1 1680
7 TraesCS7D01G478300 chr5D 225859155 225860834 1679 False 2732 2732 96.021 1 1681 1 chr5D.!!$F2 1680
8 TraesCS7D01G478300 chr5D 54749559 54751240 1681 False 2717 2717 95.838 1 1681 1 chr5D.!!$F1 1680
9 TraesCS7D01G478300 chr5D 556674747 556675418 671 False 1057 1057 95.089 1682 2351 1 chr5D.!!$F3 669
10 TraesCS7D01G478300 chr3D 234618662 234620341 1679 False 2730 2730 95.967 1 1685 1 chr3D.!!$F1 1684
11 TraesCS7D01G478300 chr3D 134621225 134621896 671 True 1046 1046 94.792 1682 2351 1 chr3D.!!$R1 669
12 TraesCS7D01G478300 chr4D 441127901 441129582 1681 False 2713 2713 95.781 1 1682 1 chr4D.!!$F2 1681
13 TraesCS7D01G478300 chr4D 365661203 365661874 671 True 1068 1068 95.387 1682 2351 1 chr4D.!!$R1 669
14 TraesCS7D01G478300 chr4D 130646208 130646881 673 False 1050 1050 94.807 1680 2351 1 chr4D.!!$F1 671
15 TraesCS7D01G478300 chr1D 449903600 449904269 669 True 1061 1061 95.238 1682 2351 1 chr1D.!!$R1 669
16 TraesCS7D01G478300 chr1D 64367968 64368636 668 False 1048 1048 94.925 1682 2351 1 chr1D.!!$F1 669
17 TraesCS7D01G478300 chr1D 269941363 269942034 671 False 1040 1040 94.643 1682 2351 1 chr1D.!!$F2 669
18 TraesCS7D01G478300 chr6D 115309766 115310437 671 False 1057 1057 95.089 1682 2351 1 chr6D.!!$F1 669

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
785 786 0.108585 AAGAGACAAAGGCCAGCGAA 59.891 50.0 5.01 0.0 0.0 4.7 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2175 2187 0.461339 ACAGACACAAACGCCGAAGT 60.461 50.0 0.0 0.0 0.0 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
59 60 2.158564 CCATGTACCAGGCTGGATCAAT 60.159 50.000 38.99 22.03 40.96 2.57
213 214 4.243008 TCGTTGCCCTTGCCGTCA 62.243 61.111 0.00 0.00 36.33 4.35
263 264 2.426023 GCGGTGACACTTGGAGGT 59.574 61.111 5.39 0.00 0.00 3.85
461 462 2.853914 GCGTTGCTCGGTGAAGAC 59.146 61.111 4.36 0.00 40.26 3.01
785 786 0.108585 AAGAGACAAAGGCCAGCGAA 59.891 50.000 5.01 0.00 0.00 4.70
789 790 2.597217 CAAAGGCCAGCGAACCCA 60.597 61.111 5.01 0.00 0.00 4.51
818 820 0.179936 GAACCCTGGATGGCAGAGAG 59.820 60.000 0.00 0.00 0.00 3.20
1031 1034 2.035237 TTGTCGAAGTGGAACGGCCT 62.035 55.000 0.00 0.00 45.86 5.19
1305 1308 2.754375 GGTGGTGACGGTGGGATT 59.246 61.111 0.00 0.00 0.00 3.01
1312 1315 3.379865 GACGGTGGGATTGGCGCTA 62.380 63.158 7.64 0.00 0.00 4.26
1352 1355 1.301716 TGGTGCCGAAGAACTGAGC 60.302 57.895 0.00 0.00 0.00 4.26
1481 1487 1.623542 CGGCAGCCCTAGGGTTTAGT 61.624 60.000 28.96 6.32 37.65 2.24
1498 1504 3.910490 TGTTTTGGTGCAGCGGCC 61.910 61.111 11.91 0.00 40.13 6.13
1695 1707 0.248289 TAACAAGGACTAGTGCGGCC 59.752 55.000 8.90 0.00 0.00 6.13
1999 2011 5.625886 GCCTGTTTAAAAACCCAACAGTCTT 60.626 40.000 9.72 0.00 39.21 3.01
2175 2187 7.297936 AGTGTCATCGGTATTATCACCATTA 57.702 36.000 0.00 0.00 38.61 1.90
2295 2309 3.659092 CTCACCCGCGCAAAAGCA 61.659 61.111 8.75 0.00 36.85 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
59 60 3.438964 GGGATACACACCATCCTACCCTA 60.439 52.174 0.00 0.00 41.55 3.53
213 214 1.669999 GCTTCCTTGGCATCGGCAAT 61.670 55.000 3.26 0.00 46.44 3.56
263 264 1.666553 GGTCGTGAACGCCATGTCA 60.667 57.895 10.20 0.00 39.60 3.58
372 373 4.704833 GCCTCTCGTGGCCAGCAA 62.705 66.667 5.11 0.00 46.82 3.91
423 424 2.826738 GAGGCTCGTCGCTCCTCT 60.827 66.667 19.12 0.77 42.31 3.69
461 462 1.353804 GAGCTCTACTCACGCCTCG 59.646 63.158 6.43 0.00 45.49 4.63
514 515 2.490217 CGACAATCTCGCCGAGGT 59.510 61.111 15.08 3.46 35.06 3.85
589 590 1.204704 CACGCTCACCTCTATTGGTCA 59.795 52.381 0.00 0.00 38.45 4.02
686 687 4.489771 CCCGCTCGATGGCCCTTT 62.490 66.667 0.00 0.00 0.00 3.11
785 786 2.356780 GGTTCCCTCGACGATGGGT 61.357 63.158 23.30 0.00 43.74 4.51
789 790 2.058595 CCAGGGTTCCCTCGACGAT 61.059 63.158 7.52 0.00 33.50 3.73
1290 1293 2.753701 CCAATCCCACCGTCACCA 59.246 61.111 0.00 0.00 0.00 4.17
1305 1308 1.241315 GCTCCCTGTTTTTAGCGCCA 61.241 55.000 2.29 0.00 0.00 5.69
1312 1315 1.599797 CCGTCGGCTCCCTGTTTTT 60.600 57.895 0.00 0.00 0.00 1.94
1352 1355 4.087892 CCCTGGCTCCGTCAGTGG 62.088 72.222 0.00 0.00 32.80 4.00
1481 1487 3.910490 GGCCGCTGCACCAAAACA 61.910 61.111 1.55 0.00 40.13 2.83
1518 1524 2.574450 GAGTCTAACCTAGGTCCTCCG 58.426 57.143 16.64 2.30 39.05 4.63
1740 1752 1.341852 TGGTCGTCTTTTCCGATCACA 59.658 47.619 0.00 0.00 40.27 3.58
1752 1764 4.158394 CCAAAATTCAATCCATGGTCGTCT 59.842 41.667 12.58 0.00 0.00 4.18
1999 2011 3.168035 ACCAGCCAATCATACCAACAA 57.832 42.857 0.00 0.00 0.00 2.83
2175 2187 0.461339 ACAGACACAAACGCCGAAGT 60.461 50.000 0.00 0.00 0.00 3.01
2295 2309 1.593787 CTCACGGCACTCATGACCT 59.406 57.895 0.00 0.00 0.00 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.