Multiple sequence alignment - TraesCS7D01G470300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G470300 chr7D 100.000 3732 0 0 1 3732 583479913 583476182 0.000000e+00 6892
1 TraesCS7D01G470300 chr7D 89.597 942 74 11 1989 2929 583982285 583983203 0.000000e+00 1175
2 TraesCS7D01G470300 chr7D 84.060 734 94 11 1286 2002 583973400 583974127 0.000000e+00 686
3 TraesCS7D01G470300 chr7D 82.794 587 66 12 1253 1827 583989146 583988583 3.350000e-135 492
4 TraesCS7D01G470300 chr7D 88.208 212 21 2 744 955 583972790 583972997 2.230000e-62 250
5 TraesCS7D01G470300 chr7D 93.413 167 9 2 795 961 583989673 583989509 2.880000e-61 246
6 TraesCS7D01G470300 chr7D 89.231 130 14 0 964 1093 583989458 583989329 2.980000e-36 163
7 TraesCS7D01G470300 chr7A 97.700 3044 33 13 1 3033 675116278 675113261 0.000000e+00 5199
8 TraesCS7D01G470300 chr7A 94.098 610 23 6 3034 3632 735161954 735161347 0.000000e+00 915
9 TraesCS7D01G470300 chr7A 93.913 115 6 1 3618 3732 735161294 735161181 4.960000e-39 172
10 TraesCS7D01G470300 chr7B 86.137 2063 257 14 675 2726 472397084 472395040 0.000000e+00 2198
11 TraesCS7D01G470300 chr7B 86.005 2015 255 14 723 2726 472330167 472328169 0.000000e+00 2134
12 TraesCS7D01G470300 chr7B 87.749 1706 165 18 1253 2932 651336460 651338147 0.000000e+00 1953
13 TraesCS7D01G470300 chr7B 87.420 1709 173 18 1253 2932 651454045 651452350 0.000000e+00 1927
14 TraesCS7D01G470300 chr7B 82.995 1529 223 14 1204 2726 651341432 651339935 0.000000e+00 1349
15 TraesCS7D01G470300 chr7B 91.054 503 30 6 677 1175 651341920 651341429 0.000000e+00 665
16 TraesCS7D01G470300 chr7B 77.280 647 128 13 1864 2502 651443714 651444349 2.740000e-96 363
17 TraesCS7D01G470300 chr7B 86.093 302 31 5 751 1045 651454513 651454216 7.780000e-82 315
18 TraesCS7D01G470300 chr6A 87.124 1561 162 16 1393 2932 146502003 146500461 0.000000e+00 1733
19 TraesCS7D01G470300 chr6A 83.384 662 63 20 732 1357 146502656 146502006 1.500000e-158 569
20 TraesCS7D01G470300 chr6A 80.762 525 57 17 1459 1976 146496315 146496802 1.640000e-98 370
21 TraesCS7D01G470300 chr3D 96.756 709 22 1 3024 3732 369479636 369480343 0.000000e+00 1181
22 TraesCS7D01G470300 chr5B 89.273 550 46 4 3087 3625 664372023 664372570 0.000000e+00 676


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G470300 chr7D 583476182 583479913 3731 True 6892.000000 6892 100.000000 1 3732 1 chr7D.!!$R1 3731
1 TraesCS7D01G470300 chr7D 583982285 583983203 918 False 1175.000000 1175 89.597000 1989 2929 1 chr7D.!!$F1 940
2 TraesCS7D01G470300 chr7D 583972790 583974127 1337 False 468.000000 686 86.134000 744 2002 2 chr7D.!!$F2 1258
3 TraesCS7D01G470300 chr7D 583988583 583989673 1090 True 300.333333 492 88.479333 795 1827 3 chr7D.!!$R2 1032
4 TraesCS7D01G470300 chr7A 675113261 675116278 3017 True 5199.000000 5199 97.700000 1 3033 1 chr7A.!!$R1 3032
5 TraesCS7D01G470300 chr7A 735161181 735161954 773 True 543.500000 915 94.005500 3034 3732 2 chr7A.!!$R2 698
6 TraesCS7D01G470300 chr7B 472395040 472397084 2044 True 2198.000000 2198 86.137000 675 2726 1 chr7B.!!$R2 2051
7 TraesCS7D01G470300 chr7B 472328169 472330167 1998 True 2134.000000 2134 86.005000 723 2726 1 chr7B.!!$R1 2003
8 TraesCS7D01G470300 chr7B 651336460 651338147 1687 False 1953.000000 1953 87.749000 1253 2932 1 chr7B.!!$F1 1679
9 TraesCS7D01G470300 chr7B 651452350 651454513 2163 True 1121.000000 1927 86.756500 751 2932 2 chr7B.!!$R4 2181
10 TraesCS7D01G470300 chr7B 651339935 651341920 1985 True 1007.000000 1349 87.024500 677 2726 2 chr7B.!!$R3 2049
11 TraesCS7D01G470300 chr7B 651443714 651444349 635 False 363.000000 363 77.280000 1864 2502 1 chr7B.!!$F2 638
12 TraesCS7D01G470300 chr6A 146500461 146502656 2195 True 1151.000000 1733 85.254000 732 2932 2 chr6A.!!$R1 2200
13 TraesCS7D01G470300 chr3D 369479636 369480343 707 False 1181.000000 1181 96.756000 3024 3732 1 chr3D.!!$F1 708
14 TraesCS7D01G470300 chr5B 664372023 664372570 547 False 676.000000 676 89.273000 3087 3625 1 chr5B.!!$F1 538

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
825 838 1.003839 CAGCCCTCAACTTACGCCA 60.004 57.895 0.0 0.0 0.0 5.69 F
1659 1953 1.005748 GGCTTGTTTCCTTGGCAGC 60.006 57.895 0.0 0.0 0.0 5.25 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2601 2912 1.743995 ACGCCGCTCCATTGGTTAC 60.744 57.895 1.86 0.0 0.0 2.50 R
3205 3535 0.033366 CTCCGATGTGTGTGTGTGGA 59.967 55.000 0.00 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
562 565 2.081425 AAAATGCCTTCAACGCGCCA 62.081 50.000 5.73 0.0 0.00 5.69
721 724 2.675348 GTCTCAATCGAAGCCAAGGAAG 59.325 50.000 0.00 0.0 0.00 3.46
825 838 1.003839 CAGCCCTCAACTTACGCCA 60.004 57.895 0.00 0.0 0.00 5.69
1659 1953 1.005748 GGCTTGTTTCCTTGGCAGC 60.006 57.895 0.00 0.0 0.00 5.25
1751 2045 1.686325 GCTCCGCAACCTCCTGGATA 61.686 60.000 0.00 0.0 37.04 2.59
2601 2912 2.869646 TGCTTTTGAGCATCGCCG 59.130 55.556 0.00 0.0 40.23 6.46
2626 2937 1.895020 AATGGAGCGGCGTGAAGGTA 61.895 55.000 9.37 0.0 0.00 3.08
2843 3168 6.540914 GTCGTATCATTTTCAGGGTGGAAATA 59.459 38.462 0.00 0.0 36.71 1.40
3153 3483 0.762418 ACCGACAAATCACCTGGTCA 59.238 50.000 0.00 0.0 0.00 4.02
3205 3535 4.047125 CTCCAACCCACCCGCCAT 62.047 66.667 0.00 0.0 0.00 4.40
3254 3584 1.067821 CGCATCTCCACTACTTCCTCC 59.932 57.143 0.00 0.0 0.00 4.30
3663 4073 4.138487 ACTAGTGGATTCAACCCGATTC 57.862 45.455 0.00 0.0 0.00 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
176 179 7.815840 TGATCATTTTCAACTTTGTGGTCTA 57.184 32.000 0.00 0.00 0.00 2.59
178 181 7.652909 TCAATGATCATTTTCAACTTTGTGGTC 59.347 33.333 18.41 0.00 0.00 4.02
562 565 2.684881 CACATTCCTATTTGGCGCTTCT 59.315 45.455 7.64 0.00 35.26 2.85
721 724 2.644992 CGGAGCCACTGGTTTTGC 59.355 61.111 0.00 0.00 0.00 3.68
782 786 2.203684 GGGGGCATATGGCTTGGG 60.204 66.667 26.45 0.00 44.01 4.12
785 789 4.603535 GGCGGGGGCATATGGCTT 62.604 66.667 26.45 0.00 44.01 4.35
787 791 4.684134 ATGGCGGGGGCATATGGC 62.684 66.667 20.55 20.55 46.84 4.40
825 838 3.371097 CTGCCACTATCGTGCCGGT 62.371 63.158 1.90 0.00 39.86 5.28
1105 1193 0.994263 GATTGCCAGCAAAATCGCAC 59.006 50.000 9.44 0.00 39.55 5.34
1751 2045 4.742138 GCTGACCTGAAAAGTTCTCTCAGT 60.742 45.833 8.13 0.00 35.78 3.41
2601 2912 1.743995 ACGCCGCTCCATTGGTTAC 60.744 57.895 1.86 0.00 0.00 2.50
2626 2937 4.018960 AGTGTCTGCCTTTTCAGGTCATAT 60.019 41.667 0.00 0.00 43.18 1.78
2641 2952 3.365767 GGAAAGCATCTTCAAGTGTCTGC 60.366 47.826 0.00 0.00 0.00 4.26
2843 3168 0.911769 TTCCCATCAACTCGAGGCAT 59.088 50.000 18.41 2.15 0.00 4.40
3205 3535 0.033366 CTCCGATGTGTGTGTGTGGA 59.967 55.000 0.00 0.00 0.00 4.02
3584 3925 3.013327 AGCAGCCAGATCCAGCCA 61.013 61.111 1.09 0.00 0.00 4.75
3663 4073 2.600731 CTCAGAAACTACAGAGCACCG 58.399 52.381 0.00 0.00 0.00 4.94
3697 4107 3.919804 CACTTAAATTGGAACCATGCACG 59.080 43.478 0.00 0.00 0.00 5.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.