Multiple sequence alignment - TraesCS7D01G464400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G464400 chr7D 100.000 2797 0 0 1 2797 579026409 579029205 0.000000e+00 5166.0
1 TraesCS7D01G464400 chr7D 99.020 102 1 0 1921 2022 606866649 606866548 1.710000e-42 183.0
2 TraesCS7D01G464400 chr7D 100.000 72 0 0 1937 2008 606872723 606872652 1.750000e-27 134.0
3 TraesCS7D01G464400 chr2D 98.435 2812 25 5 1 2797 637321095 637318288 0.000000e+00 4931.0
4 TraesCS7D01G464400 chr2D 97.125 1948 38 4 1 1934 39496980 39498923 0.000000e+00 3271.0
5 TraesCS7D01G464400 chr2D 92.353 170 11 2 1843 2011 429476983 429476815 1.000000e-59 241.0
6 TraesCS7D01G464400 chr2D 97.590 83 2 0 1929 2011 39500657 39500739 2.900000e-30 143.0
7 TraesCS7D01G464400 chr6D 98.257 2812 29 6 1 2797 108464383 108467189 0.000000e+00 4903.0
8 TraesCS7D01G464400 chr3D 97.359 1931 32 5 1 1918 523759650 523761574 0.000000e+00 3265.0
9 TraesCS7D01G464400 chr3D 96.002 2026 48 9 1 2011 308602556 308600549 0.000000e+00 3262.0
10 TraesCS7D01G464400 chr5A 97.975 1877 20 4 1 1862 73031626 73033499 0.000000e+00 3240.0
11 TraesCS7D01G464400 chr1B 97.868 1876 23 3 1 1862 638749975 638748103 0.000000e+00 3227.0
12 TraesCS7D01G464400 chr1B 97.368 38 1 0 1870 1907 2538372 2538335 6.470000e-07 65.8
13 TraesCS7D01G464400 chr7A 97.761 1876 21 5 1 1862 60106962 60105094 0.000000e+00 3212.0
14 TraesCS7D01G464400 chr3B 97.380 1870 32 4 7 1862 575754683 575752817 0.000000e+00 3166.0
15 TraesCS7D01G464400 chr3B 98.491 795 9 3 2004 2797 39815071 39815863 0.000000e+00 1399.0
16 TraesCS7D01G464400 chr6B 97.122 1876 36 4 1 1862 388367598 388365727 0.000000e+00 3149.0
17 TraesCS7D01G464400 chr2B 97.122 1876 37 3 1 1862 500714153 500716025 0.000000e+00 3149.0
18 TraesCS7D01G464400 chr2B 98.237 794 14 0 2004 2797 357246356 357245563 0.000000e+00 1389.0
19 TraesCS7D01G464400 chr2B 98.237 794 13 1 2004 2797 357277252 357276460 0.000000e+00 1387.0
20 TraesCS7D01G464400 chr3A 97.163 987 11 3 1 973 122222492 122221509 0.000000e+00 1652.0
21 TraesCS7D01G464400 chrUn 98.472 916 11 1 1 916 273320266 273319354 0.000000e+00 1611.0
22 TraesCS7D01G464400 chr4D 99.370 794 4 1 2004 2797 123738965 123738173 0.000000e+00 1437.0
23 TraesCS7D01G464400 chr4D 99.244 794 6 0 2004 2797 123656168 123655375 0.000000e+00 1434.0
24 TraesCS7D01G464400 chr4D 98.994 795 7 1 2004 2797 123509470 123508676 0.000000e+00 1423.0
25 TraesCS7D01G464400 chr7B 98.741 794 10 0 2004 2797 139543497 139542704 0.000000e+00 1411.0
26 TraesCS7D01G464400 chr5D 97.080 137 4 0 1875 2011 469489542 469489678 6.030000e-57 231.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G464400 chr7D 579026409 579029205 2796 False 5166 5166 100.0000 1 2797 1 chr7D.!!$F1 2796
1 TraesCS7D01G464400 chr2D 637318288 637321095 2807 True 4931 4931 98.4350 1 2797 1 chr2D.!!$R2 2796
2 TraesCS7D01G464400 chr2D 39496980 39500739 3759 False 1707 3271 97.3575 1 2011 2 chr2D.!!$F1 2010
3 TraesCS7D01G464400 chr6D 108464383 108467189 2806 False 4903 4903 98.2570 1 2797 1 chr6D.!!$F1 2796
4 TraesCS7D01G464400 chr3D 523759650 523761574 1924 False 3265 3265 97.3590 1 1918 1 chr3D.!!$F1 1917
5 TraesCS7D01G464400 chr3D 308600549 308602556 2007 True 3262 3262 96.0020 1 2011 1 chr3D.!!$R1 2010
6 TraesCS7D01G464400 chr5A 73031626 73033499 1873 False 3240 3240 97.9750 1 1862 1 chr5A.!!$F1 1861
7 TraesCS7D01G464400 chr1B 638748103 638749975 1872 True 3227 3227 97.8680 1 1862 1 chr1B.!!$R2 1861
8 TraesCS7D01G464400 chr7A 60105094 60106962 1868 True 3212 3212 97.7610 1 1862 1 chr7A.!!$R1 1861
9 TraesCS7D01G464400 chr3B 575752817 575754683 1866 True 3166 3166 97.3800 7 1862 1 chr3B.!!$R1 1855
10 TraesCS7D01G464400 chr3B 39815071 39815863 792 False 1399 1399 98.4910 2004 2797 1 chr3B.!!$F1 793
11 TraesCS7D01G464400 chr6B 388365727 388367598 1871 True 3149 3149 97.1220 1 1862 1 chr6B.!!$R1 1861
12 TraesCS7D01G464400 chr2B 500714153 500716025 1872 False 3149 3149 97.1220 1 1862 1 chr2B.!!$F1 1861
13 TraesCS7D01G464400 chr2B 357245563 357246356 793 True 1389 1389 98.2370 2004 2797 1 chr2B.!!$R1 793
14 TraesCS7D01G464400 chr2B 357276460 357277252 792 True 1387 1387 98.2370 2004 2797 1 chr2B.!!$R2 793
15 TraesCS7D01G464400 chr3A 122221509 122222492 983 True 1652 1652 97.1630 1 973 1 chr3A.!!$R1 972
16 TraesCS7D01G464400 chrUn 273319354 273320266 912 True 1611 1611 98.4720 1 916 1 chrUn.!!$R1 915
17 TraesCS7D01G464400 chr4D 123738173 123738965 792 True 1437 1437 99.3700 2004 2797 1 chr4D.!!$R3 793
18 TraesCS7D01G464400 chr4D 123655375 123656168 793 True 1434 1434 99.2440 2004 2797 1 chr4D.!!$R2 793
19 TraesCS7D01G464400 chr4D 123508676 123509470 794 True 1423 1423 98.9940 2004 2797 1 chr4D.!!$R1 793
20 TraesCS7D01G464400 chr7B 139542704 139543497 793 True 1411 1411 98.7410 2004 2797 1 chr7B.!!$R1 793

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
517 519 1.609072 CTCGGATCGGAGATGCTAACA 59.391 52.381 22.31 0.0 45.12 2.41 F
1137 1154 0.261696 AAGGGGGTGCAACACTTCTT 59.738 50.000 2.80 0.0 42.68 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1514 1533 0.186386 AGCCGGTGGATACTAGAGCT 59.814 55.000 1.9 0.0 37.61 4.09 R
2392 4151 6.391227 TCCTTTTTCTTCGCTTTCTTCAAT 57.609 33.333 0.0 0.0 0.00 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
382 384 5.220796 GGGCATAAAGAAATCGTCTTGGTAC 60.221 44.000 0.00 0.0 46.36 3.34
383 385 5.585047 GGCATAAAGAAATCGTCTTGGTACT 59.415 40.000 0.00 0.0 46.36 2.73
384 386 6.759827 GGCATAAAGAAATCGTCTTGGTACTA 59.240 38.462 0.00 0.0 46.36 1.82
385 387 7.254353 GGCATAAAGAAATCGTCTTGGTACTAC 60.254 40.741 0.00 0.0 46.36 2.73
517 519 1.609072 CTCGGATCGGAGATGCTAACA 59.391 52.381 22.31 0.0 45.12 2.41
783 785 6.011122 TCTTACTAATACGGAGAGGGTTCT 57.989 41.667 0.00 0.0 36.01 3.01
1137 1154 0.261696 AAGGGGGTGCAACACTTCTT 59.738 50.000 2.80 0.0 42.68 2.52
1529 1548 5.505985 CGTTTCACTAGCTCTAGTATCCACC 60.506 48.000 9.04 0.0 43.98 4.61
1935 3693 1.396653 GCCATGTGCAGGAAATAGCT 58.603 50.000 0.00 0.0 40.77 3.32
2392 4151 4.215908 AGGAGTGAGGTAGATTCGCATTA 58.784 43.478 0.00 0.0 0.00 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
382 384 4.658063 TCTATTGGTTTGGTGGTTGGTAG 58.342 43.478 0.00 0.0 0.00 3.18
383 385 4.726035 TCTATTGGTTTGGTGGTTGGTA 57.274 40.909 0.00 0.0 0.00 3.25
384 386 3.603965 TCTATTGGTTTGGTGGTTGGT 57.396 42.857 0.00 0.0 0.00 3.67
385 387 3.639094 TGTTCTATTGGTTTGGTGGTTGG 59.361 43.478 0.00 0.0 0.00 3.77
517 519 0.905357 CCCACTTCGATTCCTGTCCT 59.095 55.000 0.00 0.0 0.00 3.85
1137 1154 6.841781 AGGAGAAATATTAGGCCCAAACTA 57.158 37.500 0.00 0.0 0.00 2.24
1514 1533 0.186386 AGCCGGTGGATACTAGAGCT 59.814 55.000 1.90 0.0 37.61 4.09
1529 1548 5.520376 AATATTCCATTCCTTGAAAGCCG 57.480 39.130 0.00 0.0 0.00 5.52
1935 3693 2.844348 GGGGGAGACTCATTTTAGGACA 59.156 50.000 4.53 0.0 0.00 4.02
2392 4151 6.391227 TCCTTTTTCTTCGCTTTCTTCAAT 57.609 33.333 0.00 0.0 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.