Multiple sequence alignment - TraesCS7D01G464300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G464300 chr7D 100.000 2471 0 0 1 2471 579017683 579020153 0 4564
1 TraesCS7D01G464300 chr7D 97.510 1004 19 1 1468 2471 307122941 307123938 0 1711
2 TraesCS7D01G464300 chrUn 99.313 2473 15 2 1 2471 237255728 237253256 0 4471
3 TraesCS7D01G464300 chrUn 99.468 1691 7 2 1 1689 371043356 371041666 0 3072
4 TraesCS7D01G464300 chr4D 98.461 1689 22 4 1 1686 123518731 123517044 0 2972
5 TraesCS7D01G464300 chr1A 97.281 1692 38 5 1 1689 238107637 238105951 0 2863
6 TraesCS7D01G464300 chr1A 97.166 1694 39 6 1 1689 238153022 238151333 0 2854
7 TraesCS7D01G464300 chr5A 96.930 1694 43 5 1 1689 16575812 16574123 0 2832
8 TraesCS7D01G464300 chr7A 96.871 1694 42 7 1 1689 60326902 60325215 0 2824
9 TraesCS7D01G464300 chr7A 97.431 1012 18 1 1468 2471 60255105 60256116 0 1718
10 TraesCS7D01G464300 chr6B 96.759 1697 41 6 1 1689 596655202 596653512 0 2817
11 TraesCS7D01G464300 chr3A 96.755 1695 44 7 1 1689 247672885 247674574 0 2815
12 TraesCS7D01G464300 chr3D 98.601 1501 20 1 971 2471 602899291 602900790 0 2654
13 TraesCS7D01G464300 chr6D 98.207 1004 18 0 1468 2471 102375283 102376286 0 1755
14 TraesCS7D01G464300 chr6A 98.024 1012 12 1 1468 2471 64685523 64684512 0 1751
15 TraesCS7D01G464300 chr4B 97.530 1012 17 1 1468 2471 209062167 209061156 0 1724
16 TraesCS7D01G464300 chr2D 97.413 1005 24 2 1468 2471 604412210 604411207 0 1711
17 TraesCS7D01G464300 chr7B 97.842 973 8 2 1507 2471 742964844 742963877 0 1668


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G464300 chr7D 579017683 579020153 2470 False 4564 4564 100.000 1 2471 1 chr7D.!!$F2 2470
1 TraesCS7D01G464300 chr7D 307122941 307123938 997 False 1711 1711 97.510 1468 2471 1 chr7D.!!$F1 1003
2 TraesCS7D01G464300 chrUn 237253256 237255728 2472 True 4471 4471 99.313 1 2471 1 chrUn.!!$R1 2470
3 TraesCS7D01G464300 chrUn 371041666 371043356 1690 True 3072 3072 99.468 1 1689 1 chrUn.!!$R2 1688
4 TraesCS7D01G464300 chr4D 123517044 123518731 1687 True 2972 2972 98.461 1 1686 1 chr4D.!!$R1 1685
5 TraesCS7D01G464300 chr1A 238105951 238107637 1686 True 2863 2863 97.281 1 1689 1 chr1A.!!$R1 1688
6 TraesCS7D01G464300 chr1A 238151333 238153022 1689 True 2854 2854 97.166 1 1689 1 chr1A.!!$R2 1688
7 TraesCS7D01G464300 chr5A 16574123 16575812 1689 True 2832 2832 96.930 1 1689 1 chr5A.!!$R1 1688
8 TraesCS7D01G464300 chr7A 60325215 60326902 1687 True 2824 2824 96.871 1 1689 1 chr7A.!!$R1 1688
9 TraesCS7D01G464300 chr7A 60255105 60256116 1011 False 1718 1718 97.431 1468 2471 1 chr7A.!!$F1 1003
10 TraesCS7D01G464300 chr6B 596653512 596655202 1690 True 2817 2817 96.759 1 1689 1 chr6B.!!$R1 1688
11 TraesCS7D01G464300 chr3A 247672885 247674574 1689 False 2815 2815 96.755 1 1689 1 chr3A.!!$F1 1688
12 TraesCS7D01G464300 chr3D 602899291 602900790 1499 False 2654 2654 98.601 971 2471 1 chr3D.!!$F1 1500
13 TraesCS7D01G464300 chr6D 102375283 102376286 1003 False 1755 1755 98.207 1468 2471 1 chr6D.!!$F1 1003
14 TraesCS7D01G464300 chr6A 64684512 64685523 1011 True 1751 1751 98.024 1468 2471 1 chr6A.!!$R1 1003
15 TraesCS7D01G464300 chr4B 209061156 209062167 1011 True 1724 1724 97.530 1468 2471 1 chr4B.!!$R1 1003
16 TraesCS7D01G464300 chr2D 604411207 604412210 1003 True 1711 1711 97.413 1468 2471 1 chr2D.!!$R1 1003
17 TraesCS7D01G464300 chr7B 742963877 742964844 967 True 1668 1668 97.842 1507 2471 1 chr7B.!!$R1 964

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
726 727 1.139163 CACAAAAGCAAATGACGGGC 58.861 50.0 0.0 0.0 0.0 6.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1689 1709 2.422479 GAGATATGAGCGTGGCGGTATA 59.578 50.0 0.0 0.0 37.83 1.47 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
481 482 3.777522 CCTTTAGAGGAGGGTGAATCTGT 59.222 47.826 0.0 0.0 46.74 3.41
722 723 4.025480 CCTGAAAGCACAAAAGCAAATGAC 60.025 41.667 0.0 0.0 36.85 3.06
726 727 1.139163 CACAAAAGCAAATGACGGGC 58.861 50.000 0.0 0.0 0.00 6.13
1689 1709 3.385755 GGCATGTGGGCTTCTATCAAAAT 59.614 43.478 0.0 0.0 39.42 1.82
2465 2487 0.684479 TCGCACTCCCTACTGATGCT 60.684 55.000 0.0 0.0 34.06 3.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
481 482 3.063485 TGATTTTCAGTGAACGATCGCA 58.937 40.909 16.60 2.72 38.58 5.10
1689 1709 2.422479 GAGATATGAGCGTGGCGGTATA 59.578 50.000 0.00 0.00 37.83 1.47
2082 2104 4.704057 GGATTTGAGTCAGAGCATTTCCTT 59.296 41.667 1.04 0.00 0.00 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.