Multiple sequence alignment - TraesCS7D01G464200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G464200 chr7D 100.000 2378 0 0 1 2378 579015980 579018357 0 4392
1 TraesCS7D01G464200 chrUn 99.453 2378 10 1 1 2378 237257428 237255054 0 4316
2 TraesCS7D01G464200 chr1A 98.656 2381 29 1 1 2378 238109343 238106963 0 4217
3 TraesCS7D01G464200 chr1A 98.656 2381 29 1 1 2378 238154728 238152348 0 4217
4 TraesCS7D01G464200 chr4D 98.654 2378 32 0 1 2378 123520434 123518057 0 4215
5 TraesCS7D01G464200 chr5A 98.572 2381 31 1 1 2378 16577518 16575138 0 4205
6 TraesCS7D01G464200 chr7A 98.446 2381 34 1 1 2378 60328608 60326228 0 4189
7 TraesCS7D01G464200 chr6B 98.402 2378 37 1 1 2378 596656904 596654528 0 4180
8 TraesCS7D01G464200 chr3B 97.984 2381 43 3 1 2378 483372718 483375096 0 4126
9 TraesCS7D01G464200 chr1B 97.858 2381 45 4 1 2378 672508148 672505771 0 4109


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G464200 chr7D 579015980 579018357 2377 False 4392 4392 100.000 1 2378 1 chr7D.!!$F1 2377
1 TraesCS7D01G464200 chrUn 237255054 237257428 2374 True 4316 4316 99.453 1 2378 1 chrUn.!!$R1 2377
2 TraesCS7D01G464200 chr1A 238106963 238109343 2380 True 4217 4217 98.656 1 2378 1 chr1A.!!$R1 2377
3 TraesCS7D01G464200 chr1A 238152348 238154728 2380 True 4217 4217 98.656 1 2378 1 chr1A.!!$R2 2377
4 TraesCS7D01G464200 chr4D 123518057 123520434 2377 True 4215 4215 98.654 1 2378 1 chr4D.!!$R1 2377
5 TraesCS7D01G464200 chr5A 16575138 16577518 2380 True 4205 4205 98.572 1 2378 1 chr5A.!!$R1 2377
6 TraesCS7D01G464200 chr7A 60326228 60328608 2380 True 4189 4189 98.446 1 2378 1 chr7A.!!$R1 2377
7 TraesCS7D01G464200 chr6B 596654528 596656904 2376 True 4180 4180 98.402 1 2378 1 chr6B.!!$R1 2377
8 TraesCS7D01G464200 chr3B 483372718 483375096 2378 False 4126 4126 97.984 1 2378 1 chr3B.!!$F1 2377
9 TraesCS7D01G464200 chr1B 672505771 672508148 2377 True 4109 4109 97.858 1 2378 1 chr1B.!!$R1 2377

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
524 525 2.621338 GTTCGAATCCACATCTGAGCA 58.379 47.619 0.0 0.0 0.0 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2184 2194 3.063485 TGATTTTCAGTGAACGATCGCA 58.937 40.909 16.6 2.72 38.58 5.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
319 320 5.477510 CAGGTAGGATGCTCATAGATGAAC 58.522 45.833 0.0 0.00 36.18 3.18
501 502 3.306919 GCATTGCCCTTGAAATCCTTCAA 60.307 43.478 0.0 0.77 46.88 2.69
524 525 2.621338 GTTCGAATCCACATCTGAGCA 58.379 47.619 0.0 0.00 0.00 4.26
1213 1217 0.036388 TCACATTCCAGGCGAAGGTC 60.036 55.000 0.0 0.00 43.42 3.85
1214 1218 0.321564 CACATTCCAGGCGAAGGTCA 60.322 55.000 0.0 0.00 43.42 4.02
1215 1219 0.620556 ACATTCCAGGCGAAGGTCAT 59.379 50.000 0.0 0.00 41.54 3.06
1314 1318 3.096852 TCGAGGAGTCAAGGATTTGCTA 58.903 45.455 0.0 0.00 34.21 3.49
1588 1592 3.062042 CAGGAAGCCACAAAAAGCATTC 58.938 45.455 0.0 0.00 0.00 2.67
2184 2194 3.777522 CCTTTAGAGGAGGGTGAATCTGT 59.222 47.826 0.0 0.00 46.74 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
319 320 4.580580 ACCACTTGCCTAAAGTCTCTTTTG 59.419 41.667 0.15 0.00 46.60 2.44
501 502 3.801698 CTCAGATGTGGATTCGAACCAT 58.198 45.455 18.29 10.66 39.69 3.55
1213 1217 8.539770 ACTATAGAATGTTCCTGCGAATTATG 57.460 34.615 6.78 0.00 0.00 1.90
1214 1218 8.589338 AGACTATAGAATGTTCCTGCGAATTAT 58.411 33.333 6.78 0.00 0.00 1.28
1215 1219 7.952671 AGACTATAGAATGTTCCTGCGAATTA 58.047 34.615 6.78 0.00 0.00 1.40
1314 1318 3.069729 CCTTTCTACGATCCGGAATTCCT 59.930 47.826 22.05 3.47 0.00 3.36
1588 1592 7.897575 ACTAAAAGATCAGTTACAAGAGCAG 57.102 36.000 0.00 0.00 0.00 4.24
2184 2194 3.063485 TGATTTTCAGTGAACGATCGCA 58.937 40.909 16.60 2.72 38.58 5.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.