Multiple sequence alignment - TraesCS7D01G464100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G464100 chr7D 100.000 2357 0 0 1 2357 579015579 579017935 0 4353
1 TraesCS7D01G464100 chrUn 99.491 2357 9 1 1 2357 237257829 237255476 0 4283
2 TraesCS7D01G464100 chr1A 99.068 2360 19 1 1 2357 238109744 238107385 0 4233
3 TraesCS7D01G464100 chr1A 98.983 2360 21 1 1 2357 238155129 238152770 0 4222
4 TraesCS7D01G464100 chr5A 98.983 2360 21 1 1 2357 16577919 16575560 0 4222
5 TraesCS7D01G464100 chr4D 98.812 2357 28 0 1 2357 123520835 123518479 0 4198
6 TraesCS7D01G464100 chr6B 98.812 2357 27 1 1 2357 596657305 596654950 0 4196
7 TraesCS7D01G464100 chr6B 97.627 2360 50 5 1 2357 264841175 264838819 0 4043
8 TraesCS7D01G464100 chr6B 98.916 2122 21 2 1 2122 394496644 394498763 0 3790
9 TraesCS7D01G464100 chr1B 98.390 2360 33 3 1 2357 672508549 672506192 0 4143


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G464100 chr7D 579015579 579017935 2356 False 4353 4353 100.000 1 2357 1 chr7D.!!$F1 2356
1 TraesCS7D01G464100 chrUn 237255476 237257829 2353 True 4283 4283 99.491 1 2357 1 chrUn.!!$R1 2356
2 TraesCS7D01G464100 chr1A 238107385 238109744 2359 True 4233 4233 99.068 1 2357 1 chr1A.!!$R1 2356
3 TraesCS7D01G464100 chr1A 238152770 238155129 2359 True 4222 4222 98.983 1 2357 1 chr1A.!!$R2 2356
4 TraesCS7D01G464100 chr5A 16575560 16577919 2359 True 4222 4222 98.983 1 2357 1 chr5A.!!$R1 2356
5 TraesCS7D01G464100 chr4D 123518479 123520835 2356 True 4198 4198 98.812 1 2357 1 chr4D.!!$R1 2356
6 TraesCS7D01G464100 chr6B 596654950 596657305 2355 True 4196 4196 98.812 1 2357 1 chr6B.!!$R2 2356
7 TraesCS7D01G464100 chr6B 264838819 264841175 2356 True 4043 4043 97.627 1 2357 1 chr6B.!!$R1 2356
8 TraesCS7D01G464100 chr6B 394496644 394498763 2119 False 3790 3790 98.916 1 2122 1 chr6B.!!$F1 2121
9 TraesCS7D01G464100 chr1B 672506192 672508549 2357 True 4143 4143 98.390 1 2357 1 chr1B.!!$R1 2356

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
902 903 3.306919 GCATTGCCCTTGAAATCCTTCAA 60.307 43.478 0.0 0.77 46.88 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1989 1992 7.897575 ACTAAAAGATCAGTTACAAGAGCAG 57.102 36.0 0.0 0.0 0.0 4.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
720 721 5.477510 CAGGTAGGATGCTCATAGATGAAC 58.522 45.833 0.0 0.00 36.18 3.18
902 903 3.306919 GCATTGCCCTTGAAATCCTTCAA 60.307 43.478 0.0 0.77 46.88 2.69
1989 1992 3.062042 CAGGAAGCCACAAAAAGCATTC 58.938 45.455 0.0 0.00 0.00 2.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
720 721 4.580580 ACCACTTGCCTAAAGTCTCTTTTG 59.419 41.667 0.15 0.00 46.60 2.44
902 903 3.801698 CTCAGATGTGGATTCGAACCAT 58.198 45.455 18.29 10.66 39.69 3.55
1989 1992 7.897575 ACTAAAAGATCAGTTACAAGAGCAG 57.102 36.000 0.00 0.00 0.00 4.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.