Multiple sequence alignment - TraesCS7D01G464000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G464000 chr7D 100.000 2351 0 0 1 2351 578989874 578992224 0.000000e+00 4342
1 TraesCS7D01G464000 chr7D 97.529 2064 29 4 308 2351 307088912 307090973 0.000000e+00 3509
2 TraesCS7D01G464000 chrUn 98.692 2064 6 3 308 2351 257943528 257945590 0.000000e+00 3642
3 TraesCS7D01G464000 chrUn 98.450 2064 6 4 308 2351 233525852 233523795 0.000000e+00 3611
4 TraesCS7D01G464000 chrUn 96.423 615 2 2 1757 2351 369795034 369795648 0.000000e+00 996
5 TraesCS7D01G464000 chrUn 99.361 313 1 1 1 312 257943193 257943505 1.220000e-157 566
6 TraesCS7D01G464000 chrUn 99.042 313 2 1 1 312 429575274 429575586 5.670000e-156 560
7 TraesCS7D01G464000 chrUn 98.722 313 3 1 1 312 233526187 233525875 2.640000e-154 555
8 TraesCS7D01G464000 chr1D 98.595 2064 9 2 308 2351 212428284 212430347 0.000000e+00 3633
9 TraesCS7D01G464000 chr7B 98.353 2064 8 4 308 2351 698127517 698125460 0.000000e+00 3600
10 TraesCS7D01G464000 chr4D 98.303 2062 15 2 310 2351 123688379 123690440 0.000000e+00 3596
11 TraesCS7D01G464000 chr4D 99.042 313 2 1 1 312 123688042 123688354 5.670000e-156 560
12 TraesCS7D01G464000 chr7A 98.110 2064 19 2 308 2351 211238719 211236656 0.000000e+00 3578
13 TraesCS7D01G464000 chr7A 98.062 2064 15 3 308 2351 60096783 60094725 0.000000e+00 3567
14 TraesCS7D01G464000 chr6B 98.110 2064 14 3 308 2351 128890568 128888510 0.000000e+00 3572
15 TraesCS7D01G464000 chr2D 98.014 2064 20 3 308 2351 637309289 637307227 0.000000e+00 3565
16 TraesCS7D01G464000 chr2D 97.427 1127 9 2 1245 2351 200957774 200956648 0.000000e+00 1903
17 TraesCS7D01G464000 chr2D 99.042 313 2 1 1 312 637309624 637309312 5.670000e-156 560
18 TraesCS7D01G464000 chr2D 98.083 313 5 1 1 312 17983453 17983765 5.710000e-151 544
19 TraesCS7D01G464000 chr2D 97.764 313 5 2 1 312 306151968 306152279 2.660000e-149 538
20 TraesCS7D01G464000 chr5B 97.723 2064 22 3 308 2351 713095180 713097238 0.000000e+00 3528
21 TraesCS7D01G464000 chr6D 97.240 2065 35 4 308 2351 283186828 283188891 0.000000e+00 3478
22 TraesCS7D01G464000 chr6D 98.083 313 5 1 1 312 283186493 283186805 5.710000e-151 544
23 TraesCS7D01G464000 chr6A 97.444 313 7 1 1 312 79126230 79125918 1.240000e-147 532


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G464000 chr7D 578989874 578992224 2350 False 4342.0 4342 100.0000 1 2351 1 chr7D.!!$F2 2350
1 TraesCS7D01G464000 chr7D 307088912 307090973 2061 False 3509.0 3509 97.5290 308 2351 1 chr7D.!!$F1 2043
2 TraesCS7D01G464000 chrUn 257943193 257945590 2397 False 2104.0 3642 99.0265 1 2351 2 chrUn.!!$F3 2350
3 TraesCS7D01G464000 chrUn 233523795 233526187 2392 True 2083.0 3611 98.5860 1 2351 2 chrUn.!!$R1 2350
4 TraesCS7D01G464000 chrUn 369795034 369795648 614 False 996.0 996 96.4230 1757 2351 1 chrUn.!!$F1 594
5 TraesCS7D01G464000 chr1D 212428284 212430347 2063 False 3633.0 3633 98.5950 308 2351 1 chr1D.!!$F1 2043
6 TraesCS7D01G464000 chr7B 698125460 698127517 2057 True 3600.0 3600 98.3530 308 2351 1 chr7B.!!$R1 2043
7 TraesCS7D01G464000 chr4D 123688042 123690440 2398 False 2078.0 3596 98.6725 1 2351 2 chr4D.!!$F1 2350
8 TraesCS7D01G464000 chr7A 211236656 211238719 2063 True 3578.0 3578 98.1100 308 2351 1 chr7A.!!$R2 2043
9 TraesCS7D01G464000 chr7A 60094725 60096783 2058 True 3567.0 3567 98.0620 308 2351 1 chr7A.!!$R1 2043
10 TraesCS7D01G464000 chr6B 128888510 128890568 2058 True 3572.0 3572 98.1100 308 2351 1 chr6B.!!$R1 2043
11 TraesCS7D01G464000 chr2D 637307227 637309624 2397 True 2062.5 3565 98.5280 1 2351 2 chr2D.!!$R2 2350
12 TraesCS7D01G464000 chr2D 200956648 200957774 1126 True 1903.0 1903 97.4270 1245 2351 1 chr2D.!!$R1 1106
13 TraesCS7D01G464000 chr5B 713095180 713097238 2058 False 3528.0 3528 97.7230 308 2351 1 chr5B.!!$F1 2043
14 TraesCS7D01G464000 chr6D 283186493 283188891 2398 False 2011.0 3478 97.6615 1 2351 2 chr6D.!!$F1 2350

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1078 1110 7.018487 TCAACAAAAATGGATGGAATTGGAT 57.982 32.0 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2267 2300 6.472808 GGCATATTTCGAATATAGAGGACGTC 59.527 42.308 7.13 7.13 0.0 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1078 1110 7.018487 TCAACAAAAATGGATGGAATTGGAT 57.982 32.000 0.00 0.00 0.00 3.41
1081 1113 5.421693 ACAAAAATGGATGGAATTGGATCGA 59.578 36.000 0.00 0.00 0.00 3.59
1835 1868 1.388768 CTTGCTTGCATTGCATTCGTG 59.611 47.619 12.95 2.44 38.76 4.35
2267 2300 4.402056 ACGGTTCATAGTTGGGTATGAG 57.598 45.455 0.00 0.00 39.90 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1255 1288 4.749976 TGATGACGAATTCCACGATAACA 58.250 39.130 0.00 0.00 34.7 2.41
2267 2300 6.472808 GGCATATTTCGAATATAGAGGACGTC 59.527 42.308 7.13 7.13 0.0 4.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.