Multiple sequence alignment - TraesCS7D01G461000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G461000 chr7D 100.000 4656 0 0 1 4656 577333913 577329258 0.000000e+00 8599.0
1 TraesCS7D01G461000 chr7D 95.739 4647 113 27 4 4613 65768256 65763658 0.000000e+00 7406.0
2 TraesCS7D01G461000 chr7D 95.243 3742 100 18 1 3692 435178694 435182407 0.000000e+00 5853.0
3 TraesCS7D01G461000 chr7D 93.775 2490 84 16 1 2459 158647631 158645182 0.000000e+00 3674.0
4 TraesCS7D01G461000 chr7D 97.160 669 12 5 3947 4613 435184298 435184961 0.000000e+00 1123.0
5 TraesCS7D01G461000 chr7D 100.000 39 0 0 4618 4656 65763570 65763532 6.460000e-09 73.1
6 TraesCS7D01G461000 chr7D 100.000 39 0 0 4618 4656 435185048 435185086 6.460000e-09 73.1
7 TraesCS7D01G461000 chr3D 96.836 4646 107 17 1 4613 584383160 584378522 0.000000e+00 7729.0
8 TraesCS7D01G461000 chr3D 93.839 1818 73 11 1 1799 539614305 539612508 0.000000e+00 2700.0
9 TraesCS7D01G461000 chr3D 100.000 39 0 0 4618 4656 584378434 584378396 6.460000e-09 73.1
10 TraesCS7D01G461000 chr1A 93.497 2491 125 12 1 2460 503679155 503676671 0.000000e+00 3668.0
11 TraesCS7D01G461000 chr3A 93.272 2482 129 12 1 2454 734237813 734240284 0.000000e+00 3624.0
12 TraesCS7D01G461000 chr1B 92.826 2495 89 33 1 2459 671830317 671832757 0.000000e+00 3533.0
13 TraesCS7D01G461000 chr6A 91.970 2503 147 21 1 2460 385573375 385570884 0.000000e+00 3459.0
14 TraesCS7D01G461000 chr6A 90.607 1022 80 13 3593 4609 426778843 426777833 0.000000e+00 1341.0
15 TraesCS7D01G461000 chr2A 92.115 2473 137 14 1 2430 731834190 731836647 0.000000e+00 3434.0
16 TraesCS7D01G461000 chr2A 90.632 1409 111 15 3207 4609 577424723 577423330 0.000000e+00 1851.0
17 TraesCS7D01G461000 chr2A 96.721 61 2 0 3144 3204 577426639 577426579 8.240000e-18 102.0
18 TraesCS7D01G461000 chr7A 93.027 1893 63 16 590 2453 69160776 69158924 0.000000e+00 2700.0
19 TraesCS7D01G461000 chr7A 93.490 1782 62 16 712 2457 26229373 26227610 0.000000e+00 2599.0
20 TraesCS7D01G461000 chr7A 97.292 1403 28 9 3215 4613 69158912 69157516 0.000000e+00 2372.0
21 TraesCS7D01G461000 chr7A 90.167 1495 103 19 3144 4609 157290323 157291802 0.000000e+00 1906.0
22 TraesCS7D01G461000 chr7A 91.353 451 19 9 2627 3077 397427039 397426609 2.400000e-167 599.0
23 TraesCS7D01G461000 chr5D 97.316 1565 39 3 2383 3946 556285770 556284208 0.000000e+00 2654.0
24 TraesCS7D01G461000 chr5D 93.191 1733 96 10 1 1717 556291022 556289296 0.000000e+00 2527.0
25 TraesCS7D01G461000 chr5D 91.964 448 15 8 2627 3074 79990121 79990547 3.980000e-170 608.0
26 TraesCS7D01G461000 chr5D 100.000 40 0 0 4617 4656 419904440 419904401 1.800000e-09 75.0
27 TraesCS7D01G461000 chr5D 100.000 39 0 0 4618 4656 419904665 419904627 6.460000e-09 73.1
28 TraesCS7D01G461000 chr4D 88.718 2021 165 38 1 1989 347176375 347174386 0.000000e+00 2410.0
29 TraesCS7D01G461000 chr4D 95.665 1384 48 8 3234 4613 347172893 347171518 0.000000e+00 2213.0
30 TraesCS7D01G461000 chr4D 96.931 782 21 2 2352 3131 347173668 347172888 0.000000e+00 1308.0
31 TraesCS7D01G461000 chr4D 100.000 39 0 0 4618 4656 347171430 347171392 6.460000e-09 73.1
32 TraesCS7D01G461000 chr2D 91.037 1495 95 14 3144 4609 507085257 507086741 0.000000e+00 1982.0
33 TraesCS7D01G461000 chr1D 91.042 480 23 7 2586 3065 156007389 156006930 8.500000e-177 630.0
34 TraesCS7D01G461000 chr3B 94.724 398 7 1 2076 2459 801611728 801611331 1.430000e-169 606.0
35 TraesCS7D01G461000 chr3B 90.869 449 20 6 2627 3074 290617106 290617534 2.410000e-162 582.0
36 TraesCS7D01G461000 chr3B 91.798 317 19 3 3070 3385 744525683 744525993 7.150000e-118 435.0
37 TraesCS7D01G461000 chr4B 84.958 472 37 19 2068 2528 565112591 565113039 9.190000e-122 448.0
38 TraesCS7D01G461000 chr5A 85.821 268 17 7 2803 3067 33900878 33901127 9.930000e-67 265.0
39 TraesCS7D01G461000 chr5B 100.000 40 0 0 4617 4656 431679770 431679809 1.800000e-09 75.0
40 TraesCS7D01G461000 chr7B 100.000 39 0 0 4618 4656 612469588 612469626 6.460000e-09 73.1
41 TraesCS7D01G461000 chr6B 100.000 39 0 0 4618 4656 464412188 464412226 6.460000e-09 73.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G461000 chr7D 577329258 577333913 4655 True 8599.000 8599 100.000000 1 4656 1 chr7D.!!$R2 4655
1 TraesCS7D01G461000 chr7D 65763532 65768256 4724 True 3739.550 7406 97.869500 4 4656 2 chr7D.!!$R3 4652
2 TraesCS7D01G461000 chr7D 158645182 158647631 2449 True 3674.000 3674 93.775000 1 2459 1 chr7D.!!$R1 2458
3 TraesCS7D01G461000 chr7D 435178694 435185086 6392 False 2349.700 5853 97.467667 1 4656 3 chr7D.!!$F1 4655
4 TraesCS7D01G461000 chr3D 584378396 584383160 4764 True 3901.050 7729 98.418000 1 4656 2 chr3D.!!$R2 4655
5 TraesCS7D01G461000 chr3D 539612508 539614305 1797 True 2700.000 2700 93.839000 1 1799 1 chr3D.!!$R1 1798
6 TraesCS7D01G461000 chr1A 503676671 503679155 2484 True 3668.000 3668 93.497000 1 2460 1 chr1A.!!$R1 2459
7 TraesCS7D01G461000 chr3A 734237813 734240284 2471 False 3624.000 3624 93.272000 1 2454 1 chr3A.!!$F1 2453
8 TraesCS7D01G461000 chr1B 671830317 671832757 2440 False 3533.000 3533 92.826000 1 2459 1 chr1B.!!$F1 2458
9 TraesCS7D01G461000 chr6A 385570884 385573375 2491 True 3459.000 3459 91.970000 1 2460 1 chr6A.!!$R1 2459
10 TraesCS7D01G461000 chr6A 426777833 426778843 1010 True 1341.000 1341 90.607000 3593 4609 1 chr6A.!!$R2 1016
11 TraesCS7D01G461000 chr2A 731834190 731836647 2457 False 3434.000 3434 92.115000 1 2430 1 chr2A.!!$F1 2429
12 TraesCS7D01G461000 chr2A 577423330 577426639 3309 True 976.500 1851 93.676500 3144 4609 2 chr2A.!!$R1 1465
13 TraesCS7D01G461000 chr7A 26227610 26229373 1763 True 2599.000 2599 93.490000 712 2457 1 chr7A.!!$R1 1745
14 TraesCS7D01G461000 chr7A 69157516 69160776 3260 True 2536.000 2700 95.159500 590 4613 2 chr7A.!!$R3 4023
15 TraesCS7D01G461000 chr7A 157290323 157291802 1479 False 1906.000 1906 90.167000 3144 4609 1 chr7A.!!$F1 1465
16 TraesCS7D01G461000 chr5D 556284208 556291022 6814 True 2590.500 2654 95.253500 1 3946 2 chr5D.!!$R2 3945
17 TraesCS7D01G461000 chr4D 347171392 347176375 4983 True 1501.025 2410 95.328500 1 4656 4 chr4D.!!$R1 4655
18 TraesCS7D01G461000 chr2D 507085257 507086741 1484 False 1982.000 1982 91.037000 3144 4609 1 chr2D.!!$F1 1465

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
980 1014 2.042569 CCACATCCATCCATCCATCCAT 59.957 50.0 0.0 0.0 0.00 3.41 F
1833 1953 0.537143 AGAGCACATTGCCGAACCAA 60.537 50.0 0.0 0.0 46.52 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2222 2715 0.675083 CCAGTTTGCAAGATGCCACA 59.325 50.000 0.0 0.0 44.23 4.17 R
3684 9407 6.709397 ACAGAGCAATCATGTATAGACCATTG 59.291 38.462 0.0 0.0 0.00 2.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
256 261 5.869649 ACTTCCTTAGGCAACATTGTTTT 57.130 34.783 0.00 0.00 41.41 2.43
446 451 8.664669 ATTATTTTTCCTGGTAACTTGGTCAT 57.335 30.769 0.00 0.00 37.61 3.06
447 452 6.994421 ATTTTTCCTGGTAACTTGGTCATT 57.006 33.333 0.00 0.00 37.61 2.57
891 917 8.574196 AAATACAATTACATGCGCTTAATTCC 57.426 30.769 9.73 0.00 0.00 3.01
980 1014 2.042569 CCACATCCATCCATCCATCCAT 59.957 50.000 0.00 0.00 0.00 3.41
981 1015 3.353557 CACATCCATCCATCCATCCATC 58.646 50.000 0.00 0.00 0.00 3.51
982 1016 2.310945 ACATCCATCCATCCATCCATCC 59.689 50.000 0.00 0.00 0.00 3.51
983 1017 2.136974 TCCATCCATCCATCCATCCA 57.863 50.000 0.00 0.00 0.00 3.41
1254 1327 1.118838 CTCCGAGCCTTCATCCTCTT 58.881 55.000 0.00 0.00 0.00 2.85
1582 1683 3.441290 CCTCGCGTCCGACTCCTT 61.441 66.667 5.77 0.00 38.82 3.36
1598 1699 2.870411 CTCCTTGGTTCGTTCGTTCTTT 59.130 45.455 0.00 0.00 0.00 2.52
1790 1892 0.683973 CTGTGGTTGACCTCTCTGCT 59.316 55.000 1.34 0.00 36.82 4.24
1825 1945 3.503748 AGGTTTTGTAGAGAGCACATTGC 59.496 43.478 0.00 0.00 45.46 3.56
1833 1953 0.537143 AGAGCACATTGCCGAACCAA 60.537 50.000 0.00 0.00 46.52 3.67
2006 2457 1.089920 GTCTATTGTGCTGTGGCTGG 58.910 55.000 0.00 0.00 39.59 4.85
2222 2715 8.209584 TCGATTACTCCAGTACTGATAGTTACT 58.790 37.037 26.04 15.80 31.93 2.24
2739 6598 8.887264 AACATCAAAGGTAAAATGGGTACATA 57.113 30.769 0.00 0.00 35.94 2.29
2828 6687 7.928307 ATAGACTAAACAGTACGTACTCCAA 57.072 36.000 25.10 10.25 33.46 3.53
3386 9098 2.648059 AGGCAACATGGTGAATCTAGC 58.352 47.619 16.85 0.00 41.41 3.42
3566 9289 1.640428 CGCATGCTCTTTTCGGTCTA 58.360 50.000 17.13 0.00 0.00 2.59
3684 9407 3.553828 TTATGCCCTTGCTACCAGTAC 57.446 47.619 0.00 0.00 38.71 2.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
233 238 6.015772 GGAAAACAATGTTGCCTAAGGAAGTA 60.016 38.462 0.00 0.00 0.00 2.24
256 261 3.298619 CAAGGGTGCATATTGGAATGGA 58.701 45.455 0.00 0.00 0.00 3.41
289 294 8.747471 TCATGGCATAGTTTGTTAAAATGATCA 58.253 29.630 0.00 0.00 0.00 2.92
446 451 6.751514 ACCTTCGCATTGTGTCATTATAAA 57.248 33.333 0.00 0.00 0.00 1.40
447 452 6.751514 AACCTTCGCATTGTGTCATTATAA 57.248 33.333 0.00 0.00 0.00 0.98
891 917 1.194547 CACAAACGTCTCCACCAATCG 59.805 52.381 0.00 0.00 0.00 3.34
980 1014 1.230448 TGGGGAATGGATGGGTGGA 60.230 57.895 0.00 0.00 0.00 4.02
981 1015 1.076044 GTGGGGAATGGATGGGTGG 60.076 63.158 0.00 0.00 0.00 4.61
982 1016 1.076044 GGTGGGGAATGGATGGGTG 60.076 63.158 0.00 0.00 0.00 4.61
983 1017 2.689691 CGGTGGGGAATGGATGGGT 61.690 63.158 0.00 0.00 0.00 4.51
1240 1313 1.524482 GCCGAAGAGGATGAAGGCT 59.476 57.895 0.00 0.00 45.00 4.58
1576 1677 1.411612 AGAACGAACGAACCAAGGAGT 59.588 47.619 0.14 0.00 0.00 3.85
1582 1683 2.803956 GGATCAAAGAACGAACGAACCA 59.196 45.455 0.14 0.00 0.00 3.67
1598 1699 1.561769 AACATCACCGCCTGGGATCA 61.562 55.000 0.00 0.00 40.75 2.92
1790 1892 2.564947 ACAAAACCTGAAACAACCAGCA 59.435 40.909 0.00 0.00 0.00 4.41
1833 1953 1.831106 TCATCGCCATCTACCAACTGT 59.169 47.619 0.00 0.00 0.00 3.55
1841 1962 2.958355 TCATCTGTGTCATCGCCATCTA 59.042 45.455 0.00 0.00 0.00 1.98
1891 2012 4.751098 ACAGAAATTCGTTTAACGGTGCTA 59.249 37.500 17.59 0.00 42.81 3.49
2006 2457 1.520342 CAACTAGCGGCAGAGAGGC 60.520 63.158 1.45 0.00 39.93 4.70
2020 2471 1.108727 TACCACACGGACGTCCAACT 61.109 55.000 32.80 12.77 35.59 3.16
2222 2715 0.675083 CCAGTTTGCAAGATGCCACA 59.325 50.000 0.00 0.00 44.23 4.17
2238 2731 6.293190 CGAAGATGCTACTCTAACTACTCCAG 60.293 46.154 0.00 0.00 0.00 3.86
2582 6441 1.888512 TGGCTGCAGTCAGGAAAATTC 59.111 47.619 19.08 0.00 40.65 2.17
2739 6598 7.042797 ACTTGCAAATACAACAAGACAAGAT 57.957 32.000 0.00 0.00 42.71 2.40
2828 6687 9.019656 CCAAGATGCTACTCTAACTATCAGTAT 57.980 37.037 0.00 0.00 0.00 2.12
3566 9289 7.013274 CCAAAACACCATATCAAGATTCCGTAT 59.987 37.037 0.00 0.00 0.00 3.06
3684 9407 6.709397 ACAGAGCAATCATGTATAGACCATTG 59.291 38.462 0.00 0.00 0.00 2.82
4615 12044 8.579006 GCCCATATTCATACAAATGATTCTCAA 58.421 33.333 0.00 0.00 41.73 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.