Multiple sequence alignment - TraesCS7D01G455700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G455700 chr7D 100.000 2549 0 0 1 2549 574727689 574725141 0 4708
1 TraesCS7D01G455700 chr7D 95.629 572 22 2 1 571 58650945 58650376 0 915
2 TraesCS7D01G455700 chr5D 96.603 2002 53 8 557 2549 336262610 336264605 0 3306
3 TraesCS7D01G455700 chr5D 95.831 1991 68 10 570 2549 520497541 520495555 0 3203
4 TraesCS7D01G455700 chr5D 95.455 572 23 2 1 571 75336327 75336896 0 909
5 TraesCS7D01G455700 chr6D 96.173 1986 64 5 572 2549 109963212 109965193 0 3236
6 TraesCS7D01G455700 chr6D 96.387 1965 61 6 591 2549 52521727 52519767 0 3227
7 TraesCS7D01G455700 chr6D 95.447 571 24 1 1 571 276798820 276798252 0 909
8 TraesCS7D01G455700 chr1D 95.972 1986 69 5 571 2549 26486137 26488118 0 3214
9 TraesCS7D01G455700 chr1D 95.447 571 24 1 1 571 200599345 200598777 0 909
10 TraesCS7D01G455700 chr2D 95.884 1992 61 17 572 2549 238958886 238960870 0 3205
11 TraesCS7D01G455700 chr2D 95.829 1990 68 9 572 2549 331197179 331199165 0 3201
12 TraesCS7D01G455700 chr2D 95.455 572 23 2 1 571 248906827 248907396 0 909
13 TraesCS7D01G455700 chrUn 95.554 2002 66 14 566 2549 93726515 93724519 0 3182
14 TraesCS7D01G455700 chrUn 89.763 674 58 7 1 671 87150510 87149845 0 852
15 TraesCS7D01G455700 chr3A 95.425 1989 77 7 571 2549 735555340 735557324 0 3157
16 TraesCS7D01G455700 chr7B 90.064 1731 128 18 1 1723 734144732 734146426 0 2204
17 TraesCS7D01G455700 chr2A 95.986 573 21 2 1 571 490892104 490891532 0 929
18 TraesCS7D01G455700 chr3D 95.622 571 23 1 1 571 112599886 112599318 0 915


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G455700 chr7D 574725141 574727689 2548 True 4708 4708 100.000 1 2549 1 chr7D.!!$R2 2548
1 TraesCS7D01G455700 chr7D 58650376 58650945 569 True 915 915 95.629 1 571 1 chr7D.!!$R1 570
2 TraesCS7D01G455700 chr5D 336262610 336264605 1995 False 3306 3306 96.603 557 2549 1 chr5D.!!$F2 1992
3 TraesCS7D01G455700 chr5D 520495555 520497541 1986 True 3203 3203 95.831 570 2549 1 chr5D.!!$R1 1979
4 TraesCS7D01G455700 chr5D 75336327 75336896 569 False 909 909 95.455 1 571 1 chr5D.!!$F1 570
5 TraesCS7D01G455700 chr6D 109963212 109965193 1981 False 3236 3236 96.173 572 2549 1 chr6D.!!$F1 1977
6 TraesCS7D01G455700 chr6D 52519767 52521727 1960 True 3227 3227 96.387 591 2549 1 chr6D.!!$R1 1958
7 TraesCS7D01G455700 chr6D 276798252 276798820 568 True 909 909 95.447 1 571 1 chr6D.!!$R2 570
8 TraesCS7D01G455700 chr1D 26486137 26488118 1981 False 3214 3214 95.972 571 2549 1 chr1D.!!$F1 1978
9 TraesCS7D01G455700 chr1D 200598777 200599345 568 True 909 909 95.447 1 571 1 chr1D.!!$R1 570
10 TraesCS7D01G455700 chr2D 238958886 238960870 1984 False 3205 3205 95.884 572 2549 1 chr2D.!!$F1 1977
11 TraesCS7D01G455700 chr2D 331197179 331199165 1986 False 3201 3201 95.829 572 2549 1 chr2D.!!$F3 1977
12 TraesCS7D01G455700 chr2D 248906827 248907396 569 False 909 909 95.455 1 571 1 chr2D.!!$F2 570
13 TraesCS7D01G455700 chrUn 93724519 93726515 1996 True 3182 3182 95.554 566 2549 1 chrUn.!!$R2 1983
14 TraesCS7D01G455700 chrUn 87149845 87150510 665 True 852 852 89.763 1 671 1 chrUn.!!$R1 670
15 TraesCS7D01G455700 chr3A 735555340 735557324 1984 False 3157 3157 95.425 571 2549 1 chr3A.!!$F1 1978
16 TraesCS7D01G455700 chr7B 734144732 734146426 1694 False 2204 2204 90.064 1 1723 1 chr7B.!!$F1 1722
17 TraesCS7D01G455700 chr2A 490891532 490892104 572 True 929 929 95.986 1 571 1 chr2A.!!$R1 570
18 TraesCS7D01G455700 chr3D 112599318 112599886 568 True 915 915 95.622 1 571 1 chr3D.!!$R1 570

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
879 891 2.258591 GGCGACAGAGAGCACGAA 59.741 61.111 0.0 0.0 34.54 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2233 2280 4.431378 TCCCTACCCATGTCAAAGTCTTA 58.569 43.478 0.0 0.0 0.0 2.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 3.028850 ACATTGCTTGCAAGGCTCATAT 58.971 40.909 27.10 10.31 0.00 1.78
112 113 4.390264 CAGAGATACCTCTCCGATACACA 58.610 47.826 0.00 0.00 46.38 3.72
115 116 5.050126 AGATACCTCTCCGATACACAGAA 57.950 43.478 0.00 0.00 0.00 3.02
176 177 2.311463 CCATCGGAGACACCTGTAGAT 58.689 52.381 0.00 0.00 42.51 1.98
345 347 4.714802 TGCTAAGCTAACAGATGGGTCTTA 59.285 41.667 0.00 0.00 30.42 2.10
363 366 5.936956 GGTCTTATCCATCACATCATTCTCC 59.063 44.000 0.00 0.00 0.00 3.71
393 399 3.940852 TGTGATCCCGTTCATCAAATGAG 59.059 43.478 0.00 0.00 40.94 2.90
642 653 2.417586 CTCAGATGCGAATTGTGCTCAA 59.582 45.455 3.31 3.31 37.98 3.02
878 890 4.103103 CGGCGACAGAGAGCACGA 62.103 66.667 0.00 0.00 34.54 4.35
879 891 2.258591 GGCGACAGAGAGCACGAA 59.741 61.111 0.00 0.00 34.54 3.85
1078 1107 1.957562 CCTGTCTTCGTCTGTCCGT 59.042 57.895 0.00 0.00 0.00 4.69
1083 1112 1.105167 TCTTCGTCTGTCCGTGGTGT 61.105 55.000 0.00 0.00 0.00 4.16
1372 1402 1.316706 ACGAGCTCCGGAAGAAGAGG 61.317 60.000 5.23 0.00 43.93 3.69
1380 1410 0.905337 CGGAAGAAGAGGTGGAGGGT 60.905 60.000 0.00 0.00 0.00 4.34
1397 1427 1.436195 GGTGAAGCACGCACTGACAA 61.436 55.000 0.00 0.00 36.53 3.18
1432 1465 5.745312 TGAGCTTAGGATGTTGAAGAAGA 57.255 39.130 0.00 0.00 0.00 2.87
1433 1466 6.114187 TGAGCTTAGGATGTTGAAGAAGAA 57.886 37.500 0.00 0.00 0.00 2.52
1434 1467 6.169094 TGAGCTTAGGATGTTGAAGAAGAAG 58.831 40.000 0.00 0.00 0.00 2.85
1864 1906 5.685511 TCTTGCGTATTTTTCTGTTTTCTGC 59.314 36.000 0.00 0.00 0.00 4.26
2006 2050 9.710979 AATACAAATACACCGTGATTTAAATCG 57.289 29.630 20.45 11.85 38.26 3.34
2233 2280 2.766828 GGTAACTGCTAGGACAGATGGT 59.233 50.000 4.57 0.00 40.25 3.55
2266 2313 2.771688 TGGGTAGGGAAGGAAGGTATG 58.228 52.381 0.00 0.00 0.00 2.39
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 2.419990 CCCTCTCGGTAATGCACATCAA 60.420 50.000 0.00 0.00 0.00 2.57
112 113 7.961351 AGATCGAGATTAGGATTTGTCATTCT 58.039 34.615 0.00 0.00 0.00 2.40
115 116 7.763528 GCATAGATCGAGATTAGGATTTGTCAT 59.236 37.037 0.00 0.00 0.00 3.06
176 177 7.788026 ACGTAACTGGGTGATTATAAAGATGA 58.212 34.615 0.00 0.00 0.00 2.92
345 347 5.948842 TCATTGGAGAATGATGTGATGGAT 58.051 37.500 0.00 0.00 42.56 3.41
363 366 3.009026 TGAACGGGATCACACATCATTG 58.991 45.455 0.00 0.00 0.00 2.82
369 372 2.849294 TTGATGAACGGGATCACACA 57.151 45.000 0.00 0.00 29.39 3.72
370 373 3.689161 TCATTTGATGAACGGGATCACAC 59.311 43.478 0.00 0.00 36.11 3.82
393 399 6.879458 AGTTTCCTAACCATAGACATGTGTTC 59.121 38.462 1.15 0.00 34.71 3.18
426 433 9.587772 TCTACTTGACTAGCTCATTAATCAAAC 57.412 33.333 0.00 0.00 0.00 2.93
588 599 0.473694 ACATGGACACCACTGAGGGA 60.474 55.000 0.00 0.00 43.89 4.20
642 653 0.107165 GCTCGGACTAGGGGCAAAAT 60.107 55.000 0.00 0.00 0.00 1.82
878 890 0.536687 TCTCTCGTCGTGGTCACCTT 60.537 55.000 0.00 0.00 0.00 3.50
879 891 0.956410 CTCTCTCGTCGTGGTCACCT 60.956 60.000 0.00 0.00 0.00 4.00
890 902 0.742990 CCGTGCTCTCTCTCTCTCGT 60.743 60.000 0.00 0.00 0.00 4.18
940 969 1.211457 CTCCACAGCTAGCTTCCCAAT 59.789 52.381 16.46 0.00 0.00 3.16
941 970 0.615331 CTCCACAGCTAGCTTCCCAA 59.385 55.000 16.46 0.00 0.00 4.12
1222 1252 0.667993 ACCTGCATGAACACCAAACG 59.332 50.000 0.00 0.00 0.00 3.60
1308 1338 0.803380 GCATGCGCAACCATTCTTCC 60.803 55.000 17.11 0.00 38.36 3.46
1372 1402 3.050275 GCGTGCTTCACCCTCCAC 61.050 66.667 0.00 0.00 0.00 4.02
1380 1410 0.657312 CTTTGTCAGTGCGTGCTTCA 59.343 50.000 0.00 0.00 0.00 3.02
1432 1465 5.505181 TGATCTTCAAGCTTCCTAACCTT 57.495 39.130 0.00 0.00 0.00 3.50
1433 1466 5.495640 CTTGATCTTCAAGCTTCCTAACCT 58.504 41.667 0.00 0.00 46.03 3.50
1434 1467 5.809719 CTTGATCTTCAAGCTTCCTAACC 57.190 43.478 0.00 0.00 46.03 2.85
1632 1667 6.135290 TGTTGGTCACATCTTCTCTTTTTG 57.865 37.500 0.00 0.00 0.00 2.44
1635 1670 6.966534 AAATGTTGGTCACATCTTCTCTTT 57.033 33.333 0.00 0.00 46.23 2.52
1983 2027 7.367159 TCGATTTAAATCACGGTGTATTTGT 57.633 32.000 24.23 11.06 35.11 2.83
2006 2050 6.930722 ACATTTTCCATGACATTTTGGTCTTC 59.069 34.615 0.00 0.00 38.61 2.87
2233 2280 4.431378 TCCCTACCCATGTCAAAGTCTTA 58.569 43.478 0.00 0.00 0.00 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.