Multiple sequence alignment - TraesCS7D01G451100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G451100 chr7D 100.000 2243 0 0 1 2243 570674609 570672367 0.000000e+00 4143.0
1 TraesCS7D01G451100 chr7D 96.552 58 1 1 1734 1790 552502940 552502883 6.590000e-16 95.3
2 TraesCS7D01G451100 chr5D 95.786 2278 58 13 1 2243 432779522 432777248 0.000000e+00 3640.0
3 TraesCS7D01G451100 chr5D 92.361 144 6 4 2102 2243 432773966 432773826 1.360000e-47 200.0
4 TraesCS7D01G451100 chr5D 98.413 63 1 0 2057 2119 432774043 432773981 6.550000e-21 111.0
5 TraesCS7D01G451100 chr6B 92.151 2255 133 16 1 2242 60080147 60077924 0.000000e+00 3144.0
6 TraesCS7D01G451100 chr6B 96.408 1364 41 5 760 2119 694395749 694397108 0.000000e+00 2241.0
7 TraesCS7D01G451100 chr6B 94.915 118 4 2 2099 2214 694397134 694397251 1.370000e-42 183.0
8 TraesCS7D01G451100 chr6B 94.340 106 4 1 2140 2243 694397247 694397352 6.410000e-36 161.0
9 TraesCS7D01G451100 chr2D 92.090 2263 116 17 1 2243 610421378 610419159 0.000000e+00 3129.0
10 TraesCS7D01G451100 chr7A 90.146 2263 159 28 1 2242 711984943 711987162 0.000000e+00 2885.0
11 TraesCS7D01G451100 chr7A 90.826 109 9 1 1849 1957 638242240 638242133 6.460000e-31 145.0
12 TraesCS7D01G451100 chr3B 90.479 1670 96 28 594 2243 540479586 540477960 0.000000e+00 2145.0
13 TraesCS7D01G451100 chr3B 87.601 1113 84 22 1146 2243 71113858 71112785 0.000000e+00 1242.0
14 TraesCS7D01G451100 chr2A 92.459 1273 95 1 1 1273 25353764 25352493 0.000000e+00 1818.0
15 TraesCS7D01G451100 chr6A 91.673 1273 103 2 1 1273 282150536 282149267 0.000000e+00 1760.0
16 TraesCS7D01G451100 chr6A 93.200 1000 33 20 1277 2243 21344708 21343711 0.000000e+00 1437.0
17 TraesCS7D01G451100 chr3D 91.366 1274 109 1 1 1274 209670829 209672101 0.000000e+00 1742.0
18 TraesCS7D01G451100 chr3D 88.270 341 34 5 1220 1558 209672116 209672452 9.650000e-109 403.0
19 TraesCS7D01G451100 chr2B 90.945 1259 113 1 16 1274 667804462 667805719 0.000000e+00 1692.0
20 TraesCS7D01G451100 chr4A 90.517 1276 115 5 1 1273 616710502 616711774 0.000000e+00 1681.0
21 TraesCS7D01G451100 chr6D 87.427 342 37 5 1220 1558 466382217 466382555 2.700000e-104 388.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G451100 chr7D 570672367 570674609 2242 True 4143.000000 4143 100.000 1 2243 1 chr7D.!!$R2 2242
1 TraesCS7D01G451100 chr5D 432773826 432779522 5696 True 1317.000000 3640 95.520 1 2243 3 chr5D.!!$R1 2242
2 TraesCS7D01G451100 chr6B 60077924 60080147 2223 True 3144.000000 3144 92.151 1 2242 1 chr6B.!!$R1 2241
3 TraesCS7D01G451100 chr6B 694395749 694397352 1603 False 861.666667 2241 95.221 760 2243 3 chr6B.!!$F1 1483
4 TraesCS7D01G451100 chr2D 610419159 610421378 2219 True 3129.000000 3129 92.090 1 2243 1 chr2D.!!$R1 2242
5 TraesCS7D01G451100 chr7A 711984943 711987162 2219 False 2885.000000 2885 90.146 1 2242 1 chr7A.!!$F1 2241
6 TraesCS7D01G451100 chr3B 540477960 540479586 1626 True 2145.000000 2145 90.479 594 2243 1 chr3B.!!$R2 1649
7 TraesCS7D01G451100 chr3B 71112785 71113858 1073 True 1242.000000 1242 87.601 1146 2243 1 chr3B.!!$R1 1097
8 TraesCS7D01G451100 chr2A 25352493 25353764 1271 True 1818.000000 1818 92.459 1 1273 1 chr2A.!!$R1 1272
9 TraesCS7D01G451100 chr6A 282149267 282150536 1269 True 1760.000000 1760 91.673 1 1273 1 chr6A.!!$R2 1272
10 TraesCS7D01G451100 chr6A 21343711 21344708 997 True 1437.000000 1437 93.200 1277 2243 1 chr6A.!!$R1 966
11 TraesCS7D01G451100 chr3D 209670829 209672452 1623 False 1072.500000 1742 89.818 1 1558 2 chr3D.!!$F1 1557
12 TraesCS7D01G451100 chr2B 667804462 667805719 1257 False 1692.000000 1692 90.945 16 1274 1 chr2B.!!$F1 1258
13 TraesCS7D01G451100 chr4A 616710502 616711774 1272 False 1681.000000 1681 90.517 1 1273 1 chr4A.!!$F1 1272

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
70 71 0.978151 TGCCTTCAAGCCATGCATTT 59.022 45.000 0.0 0.0 0.00 2.32 F
1084 1089 1.912043 AGCTTACCAAGAGTGCTGGAT 59.088 47.619 0.0 0.0 32.32 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1197 1202 2.296752 TCGGTCCACGTCACTTTCAATA 59.703 45.455 0.0 0.0 44.69 1.90 R
2119 2217 2.421073 TCCTAGTCACGTACACCATTCG 59.579 50.000 0.0 0.0 0.00 3.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
70 71 0.978151 TGCCTTCAAGCCATGCATTT 59.022 45.000 0.00 0.0 0.00 2.32
104 105 3.118038 GCAGGGTGTAGACCATATTTGGA 60.118 47.826 11.75 0.0 46.92 3.53
193 195 3.942748 GCATAGTTGGATGTTTCCGGTAA 59.057 43.478 0.00 0.0 45.89 2.85
265 269 2.428171 GAGCAGCTGAAATTGGCCATTA 59.572 45.455 20.43 0.0 0.00 1.90
359 363 7.396540 ACCCAAATTGTGAACATAGAGAATC 57.603 36.000 0.00 0.0 0.00 2.52
427 431 8.967918 GTGACATACTAGATAATATGTGGCCTA 58.032 37.037 3.32 0.0 41.12 3.93
513 517 5.048504 CACCGATGCAATAGCCTATTTGAAT 60.049 40.000 0.00 0.0 41.13 2.57
724 729 5.106791 GCTGATGCATTGCTAGGTTACATAG 60.107 44.000 10.49 0.0 39.41 2.23
803 808 3.748048 GCAAGAGCATCGCCAAATATAGA 59.252 43.478 0.00 0.0 42.67 1.98
827 832 6.022107 TGAGATTTCAGGAAATGGATGGAT 57.978 37.500 11.70 0.0 40.77 3.41
1084 1089 1.912043 AGCTTACCAAGAGTGCTGGAT 59.088 47.619 0.00 0.0 32.32 3.41
1197 1202 0.917533 AGACATGCAAGGAGCCAGAT 59.082 50.000 0.00 0.0 44.83 2.90
1326 1400 9.214957 CTAACAATGTTGTATTGAACTGTAGGA 57.785 33.333 9.15 0.0 41.31 2.94
1544 1621 3.755112 TTGGTTGTGAGAACCGTGATA 57.245 42.857 7.03 0.0 43.15 2.15
1551 1628 3.438781 TGTGAGAACCGTGATATTTTGCC 59.561 43.478 0.00 0.0 0.00 4.52
1870 1966 8.812972 TCTTGTGGCTAATACTAGAAAGAAGAA 58.187 33.333 0.00 0.0 29.35 2.52
1895 1991 6.620877 TCCAACACTAGGACATCTACATTT 57.379 37.500 0.00 0.0 0.00 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
70 71 1.133009 ACACCCTGCCAAAAACCCATA 60.133 47.619 0.00 0.0 0.00 2.74
104 105 5.010012 CCACTAAGAAAAGTTGCATCAACCT 59.990 40.000 6.12 0.0 44.49 3.50
221 225 6.736581 TCCATGAACCATACCCAATTTTCTA 58.263 36.000 0.00 0.0 0.00 2.10
427 431 5.658634 TCTCTACTTCATATGTCCAAGCTGT 59.341 40.000 1.90 0.0 0.00 4.40
724 729 7.166691 TCAACTCCTTTATCACACTAGGTAC 57.833 40.000 0.00 0.0 0.00 3.34
803 808 6.022107 TCCATCCATTTCCTGAAATCTCAT 57.978 37.500 2.19 0.0 38.84 2.90
827 832 1.139256 TCTCCAAGTTAACGGTGTGCA 59.861 47.619 0.00 0.0 0.00 4.57
1084 1089 6.261435 TCTTTATCCTCCTAGTTCTTGGACA 58.739 40.000 0.00 0.0 0.00 4.02
1197 1202 2.296752 TCGGTCCACGTCACTTTCAATA 59.703 45.455 0.00 0.0 44.69 1.90
1544 1621 6.155049 AGCAAAACTCATACCATAGGCAAAAT 59.845 34.615 0.00 0.0 0.00 1.82
1551 1628 7.552687 TCCAGTAAAGCAAAACTCATACCATAG 59.447 37.037 0.00 0.0 0.00 2.23
1846 1942 9.959721 ATTTCTTCTTTCTAGTATTAGCCACAA 57.040 29.630 0.00 0.0 0.00 3.33
1870 1966 6.814954 ATGTAGATGTCCTAGTGTTGGATT 57.185 37.500 0.00 0.0 35.87 3.01
1985 2082 3.406764 AGAACTGCAACTGATCAAGGAC 58.593 45.455 0.00 0.0 0.00 3.85
2056 2154 4.140663 ACCATAGGATAGGAGTACTGGCTT 60.141 45.833 0.00 0.0 0.00 4.35
2119 2217 2.421073 TCCTAGTCACGTACACCATTCG 59.579 50.000 0.00 0.0 0.00 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.