Multiple sequence alignment - TraesCS7D01G446800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G446800 chr7D 100.000 2550 0 0 1 2550 567321948 567324497 0 4710
1 TraesCS7D01G446800 chr7D 98.709 2556 25 7 1 2550 589613561 589611008 0 4530
2 TraesCS7D01G446800 chr7D 98.706 2551 28 5 1 2550 200270832 200273378 0 4523
3 TraesCS7D01G446800 chr7D 98.550 2552 25 6 1 2550 253131818 253129277 0 4497
4 TraesCS7D01G446800 chr3D 99.060 2552 21 3 1 2550 68827313 68824763 0 4577
5 TraesCS7D01G446800 chr1D 98.903 2553 24 4 1 2550 203582798 203585349 0 4556
6 TraesCS7D01G446800 chr1D 98.863 2551 25 4 1 2550 19993844 19991297 0 4547
7 TraesCS7D01G446800 chr5D 98.865 2555 21 7 1 2550 335823457 335826008 0 4551
8 TraesCS7D01G446800 chr5D 98.865 2555 20 8 1 2550 55024048 55021498 0 4549
9 TraesCS7D01G446800 chr2D 98.707 2553 27 6 1 2550 378264482 378267031 0 4527


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G446800 chr7D 567321948 567324497 2549 False 4710 4710 100.000 1 2550 1 chr7D.!!$F2 2549
1 TraesCS7D01G446800 chr7D 589611008 589613561 2553 True 4530 4530 98.709 1 2550 1 chr7D.!!$R2 2549
2 TraesCS7D01G446800 chr7D 200270832 200273378 2546 False 4523 4523 98.706 1 2550 1 chr7D.!!$F1 2549
3 TraesCS7D01G446800 chr7D 253129277 253131818 2541 True 4497 4497 98.550 1 2550 1 chr7D.!!$R1 2549
4 TraesCS7D01G446800 chr3D 68824763 68827313 2550 True 4577 4577 99.060 1 2550 1 chr3D.!!$R1 2549
5 TraesCS7D01G446800 chr1D 203582798 203585349 2551 False 4556 4556 98.903 1 2550 1 chr1D.!!$F1 2549
6 TraesCS7D01G446800 chr1D 19991297 19993844 2547 True 4547 4547 98.863 1 2550 1 chr1D.!!$R1 2549
7 TraesCS7D01G446800 chr5D 335823457 335826008 2551 False 4551 4551 98.865 1 2550 1 chr5D.!!$F1 2549
8 TraesCS7D01G446800 chr5D 55021498 55024048 2550 True 4549 4549 98.865 1 2550 1 chr5D.!!$R1 2549
9 TraesCS7D01G446800 chr2D 378264482 378267031 2549 False 4527 4527 98.707 1 2550 1 chr2D.!!$F1 2549

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
526 534 4.262592 GCCATTTGAAATCTGGTCAAACCT 60.263 41.667 1.94 0.0 45.19 3.5 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1764 1773 5.073311 TCAAGTACTGCTTACTGTCATCC 57.927 43.478 0.0 0.0 40.44 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
526 534 4.262592 GCCATTTGAAATCTGGTCAAACCT 60.263 41.667 1.94 0.0 45.19 3.50
536 544 5.853572 TCTGGTCAAACCTTAATAACCCT 57.146 39.130 0.00 0.0 39.58 4.34
1054 1063 1.980052 CCGGTGTATGGTCCAGTGT 59.020 57.895 0.00 0.0 0.00 3.55
1250 1259 8.722480 ATCTATCACATTTCGTTTTCAGATCA 57.278 30.769 0.00 0.0 0.00 2.92
1428 1437 4.142138 GGTGGTAGATGTCGAACTGAAGAT 60.142 45.833 0.00 0.0 0.00 2.40
1764 1773 1.469308 GGATCATACCCTAGCTCGTCG 59.531 57.143 0.00 0.0 0.00 5.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
526 534 4.020928 TGAGCGAGTCAACAGGGTTATTAA 60.021 41.667 0.00 0.0 29.64 1.40
536 544 1.066430 GGGGTTATGAGCGAGTCAACA 60.066 52.381 0.00 0.0 39.19 3.33
1166 1175 0.343372 AGATCTAACCTGCCCCTCCA 59.657 55.000 0.00 0.0 0.00 3.86
1250 1259 3.763360 TCGAAATGGTGGCATTTCTTCAT 59.237 39.130 5.61 0.0 44.83 2.57
1428 1437 7.503566 AGTTCTTGTTCATCTTCTTCAATTCCA 59.496 33.333 0.00 0.0 0.00 3.53
1764 1773 5.073311 TCAAGTACTGCTTACTGTCATCC 57.927 43.478 0.00 0.0 40.44 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.