Multiple sequence alignment - TraesCS7D01G442400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G442400 chr7D 100.000 2336 0 0 1 2336 561874533 561876868 0.000000e+00 4314.0
1 TraesCS7D01G442400 chr7D 92.896 183 11 1 2156 2336 561874496 561874314 4.950000e-67 265.0
2 TraesCS7D01G442400 chr6B 93.658 1356 57 8 1 1337 578773713 578775058 0.000000e+00 2001.0
3 TraesCS7D01G442400 chr6B 91.956 1007 38 9 1332 2334 578775328 578776295 0.000000e+00 1371.0
4 TraesCS7D01G442400 chr6B 88.875 782 69 6 1564 2333 719101595 719102370 0.000000e+00 946.0
5 TraesCS7D01G442400 chr6B 91.718 652 52 2 5 656 18590235 18590884 0.000000e+00 904.0
6 TraesCS7D01G442400 chr6B 89.925 665 48 6 1683 2335 18592154 18592811 0.000000e+00 839.0
7 TraesCS7D01G442400 chr6B 91.897 580 42 1 77 656 719099995 719100569 0.000000e+00 806.0
8 TraesCS7D01G442400 chr6B 90.710 183 15 1 2156 2336 578773676 578773494 2.320000e-60 243.0
9 TraesCS7D01G442400 chr6B 92.857 154 6 3 2185 2335 719099873 719099722 3.910000e-53 219.0
10 TraesCS7D01G442400 chr2D 94.970 1014 48 3 1 1013 22814710 22815721 0.000000e+00 1587.0
11 TraesCS7D01G442400 chr2D 91.985 786 40 8 1563 2336 22816318 22817092 0.000000e+00 1081.0
12 TraesCS7D01G442400 chr2D 92.774 429 27 2 303 727 453569428 453569856 3.300000e-173 617.0
13 TraesCS7D01G442400 chr2D 88.319 351 29 6 1626 1970 453604585 453604929 6.010000e-111 411.0
14 TraesCS7D01G442400 chr2D 89.316 234 11 4 781 1013 453569877 453570097 4.910000e-72 281.0
15 TraesCS7D01G442400 chr7B 90.855 667 43 4 1682 2336 665726361 665727021 0.000000e+00 878.0
16 TraesCS7D01G442400 chr7B 90.382 655 61 2 2 656 665724477 665725129 0.000000e+00 859.0
17 TraesCS7D01G442400 chr7B 87.348 577 38 19 1004 1556 722094434 722094999 1.520000e-176 628.0
18 TraesCS7D01G442400 chr7B 95.833 72 3 0 1563 1634 665726289 665726360 1.470000e-22 117.0
19 TraesCS7D01G442400 chr7B 85.000 120 9 4 1897 2007 246617970 246618089 1.900000e-21 113.0
20 TraesCS7D01G442400 chr2A 89.892 554 40 7 1563 2106 596358729 596359276 0.000000e+00 699.0
21 TraesCS7D01G442400 chr2A 93.103 319 22 0 303 621 596357769 596358087 3.510000e-128 468.0
22 TraesCS7D01G442400 chr6D 87.175 577 40 18 1007 1556 17042904 17042335 1.970000e-175 625.0
23 TraesCS7D01G442400 chr6D 87.719 171 15 5 2171 2336 456099266 456099435 6.590000e-46 195.0
24 TraesCS7D01G442400 chr6D 100.000 34 0 0 1564 1597 456099074 456099107 1.940000e-06 63.9
25 TraesCS7D01G442400 chr3B 87.197 578 39 19 1006 1556 379653800 379654369 1.970000e-175 625.0
26 TraesCS7D01G442400 chr3B 90.854 164 4 6 1397 1556 367031989 367031833 2.350000e-50 209.0
27 TraesCS7D01G442400 chr1D 96.986 365 8 3 1004 1368 469795632 469795993 5.520000e-171 610.0
28 TraesCS7D01G442400 chr1D 95.288 191 4 2 1370 1556 469796026 469796215 4.880000e-77 298.0
29 TraesCS7D01G442400 chr1D 88.333 180 20 1 834 1012 111015343 111015522 5.060000e-52 215.0
30 TraesCS7D01G442400 chr1D 88.496 113 13 0 834 946 111011014 111011126 1.130000e-28 137.0
31 TraesCS7D01G442400 chr5B 86.552 580 45 15 1004 1556 328273868 328274441 1.980000e-170 608.0
32 TraesCS7D01G442400 chr5B 85.965 342 33 6 1 327 277130634 277130293 3.690000e-93 351.0
33 TraesCS7D01G442400 chr5B 90.110 182 18 0 419 600 277129911 277130092 1.080000e-58 237.0
34 TraesCS7D01G442400 chr1A 96.196 368 11 3 1004 1371 562902567 562902931 1.190000e-167 599.0
35 TraesCS7D01G442400 chr1A 93.684 190 6 3 1370 1555 562902961 562903148 1.770000e-71 279.0
36 TraesCS7D01G442400 chr1A 83.478 230 27 9 786 1013 117193203 117193423 1.090000e-48 204.0
37 TraesCS7D01G442400 chr1B 95.380 368 11 4 1004 1371 649670289 649670650 4.330000e-162 580.0
38 TraesCS7D01G442400 chr1B 95.812 191 4 1 1370 1556 649670680 649670870 2.920000e-79 305.0
39 TraesCS7D01G442400 chr1B 88.950 181 19 1 834 1013 169643244 169643424 3.020000e-54 222.0
40 TraesCS7D01G442400 chr5A 91.576 368 31 0 1004 1371 69536234 69536601 2.070000e-140 508.0
41 TraesCS7D01G442400 chr5A 85.088 342 36 5 1 327 328082762 328082421 3.720000e-88 335.0
42 TraesCS7D01G442400 chr5D 85.673 342 34 5 1 327 243881671 243881330 1.720000e-91 346.0
43 TraesCS7D01G442400 chr5D 90.659 182 17 0 419 600 243880948 243881129 2.320000e-60 243.0
44 TraesCS7D01G442400 chr5D 81.667 120 10 6 1900 2007 30421514 30421395 3.200000e-14 89.8
45 TraesCS7D01G442400 chr6A 81.818 418 44 16 1165 1556 214075708 214075297 2.900000e-84 322.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G442400 chr7D 561874533 561876868 2335 False 4314.0 4314 100.000000 1 2336 1 chr7D.!!$F1 2335
1 TraesCS7D01G442400 chr6B 578773713 578776295 2582 False 1686.0 2001 92.807000 1 2334 2 chr6B.!!$F2 2333
2 TraesCS7D01G442400 chr6B 719099995 719102370 2375 False 876.0 946 90.386000 77 2333 2 chr6B.!!$F3 2256
3 TraesCS7D01G442400 chr6B 18590235 18592811 2576 False 871.5 904 90.821500 5 2335 2 chr6B.!!$F1 2330
4 TraesCS7D01G442400 chr2D 22814710 22817092 2382 False 1334.0 1587 93.477500 1 2336 2 chr2D.!!$F2 2335
5 TraesCS7D01G442400 chr2D 453569428 453570097 669 False 449.0 617 91.045000 303 1013 2 chr2D.!!$F3 710
6 TraesCS7D01G442400 chr7B 722094434 722094999 565 False 628.0 628 87.348000 1004 1556 1 chr7B.!!$F2 552
7 TraesCS7D01G442400 chr7B 665724477 665727021 2544 False 618.0 878 92.356667 2 2336 3 chr7B.!!$F3 2334
8 TraesCS7D01G442400 chr2A 596357769 596359276 1507 False 583.5 699 91.497500 303 2106 2 chr2A.!!$F1 1803
9 TraesCS7D01G442400 chr6D 17042335 17042904 569 True 625.0 625 87.175000 1007 1556 1 chr6D.!!$R1 549
10 TraesCS7D01G442400 chr3B 379653800 379654369 569 False 625.0 625 87.197000 1006 1556 1 chr3B.!!$F1 550
11 TraesCS7D01G442400 chr1D 469795632 469796215 583 False 454.0 610 96.137000 1004 1556 2 chr1D.!!$F3 552
12 TraesCS7D01G442400 chr5B 328273868 328274441 573 False 608.0 608 86.552000 1004 1556 1 chr5B.!!$F2 552
13 TraesCS7D01G442400 chr1A 562902567 562903148 581 False 439.0 599 94.940000 1004 1555 2 chr1A.!!$F2 551
14 TraesCS7D01G442400 chr1B 649670289 649670870 581 False 442.5 580 95.596000 1004 1556 2 chr1B.!!$F2 552

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
177 178 0.734253 CGAGCTCAACCTCCTCAACG 60.734 60.0 15.4 0.0 0.0 4.1 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2136 4332 0.035439 AAATGACGCAATCCCCTCGT 60.035 50.0 0.0 0.0 39.33 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 3.016474 GCCTCACTTGCTTCGTCGC 62.016 63.158 0.00 0.00 0.00 5.19
37 38 2.357517 CACTTGCTTCGTCGCCCT 60.358 61.111 0.00 0.00 0.00 5.19
147 148 1.339055 CCTCCTTTCTTGTCATCGCCA 60.339 52.381 0.00 0.00 0.00 5.69
177 178 0.734253 CGAGCTCAACCTCCTCAACG 60.734 60.000 15.40 0.00 0.00 4.10
197 198 2.202663 GAGCTCTGTCGCATCGCA 60.203 61.111 6.43 0.00 0.00 5.10
297 298 2.038269 AAATCGCCGGCATTCACGT 61.038 52.632 28.98 7.39 0.00 4.49
552 554 2.445682 ATACACGGAGAGGAAGAGCT 57.554 50.000 0.00 0.00 0.00 4.09
594 596 4.697756 CCGTCATGGTGGCACCGT 62.698 66.667 30.14 27.96 42.58 4.83
636 638 2.183300 CGCTCCGTCCATTCCGAA 59.817 61.111 0.00 0.00 0.00 4.30
647 649 1.011968 CATTCCGAACGTCGAAGGCA 61.012 55.000 0.00 0.00 43.74 4.75
752 754 2.445682 AGCTCACTGAGTAGTAGGGG 57.554 55.000 7.89 0.00 34.74 4.79
892 912 2.968697 GACGCCGACGGGTTGTTT 60.969 61.111 17.22 0.00 46.04 2.83
928 948 2.203070 GGAGTACATGGCCGCCTG 60.203 66.667 11.61 8.98 0.00 4.85
1600 3780 3.957435 ATCACCGTCCCGCTCCTCA 62.957 63.158 0.00 0.00 0.00 3.86
1741 3921 1.961394 ACGTGAACCTGTTGCTCTCTA 59.039 47.619 0.00 0.00 0.00 2.43
1895 4082 1.068250 GTGCCGGTGATCTAGCTCC 59.932 63.158 1.90 0.00 0.00 4.70
1920 4107 1.915266 AGCAGCAGCCTGAGGTACA 60.915 57.895 0.00 0.00 41.77 2.90
2027 4223 0.395862 TTGCAAAAGACCCCCAACGA 60.396 50.000 0.00 0.00 0.00 3.85
2136 4332 1.305887 GAACGAGGGGAGGAGGGAA 60.306 63.158 0.00 0.00 0.00 3.97
2183 4380 4.052518 CCCCCTGGTTCCCTGCTG 62.053 72.222 0.00 0.00 0.00 4.41
2220 4417 0.242017 GATGTGGCAGTCAAAGCACC 59.758 55.000 0.00 0.00 0.00 5.01
2227 4424 0.825010 CAGTCAAAGCACCCTTGGCT 60.825 55.000 0.00 0.00 45.15 4.75
2278 4476 5.581126 ACGTAGACCAAACCGTATAATGA 57.419 39.130 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
12 13 0.250901 ACGAAGCAAGTGAGGCCAAT 60.251 50.000 5.01 0.00 0.00 3.16
21 22 2.357517 CAGGGCGACGAAGCAAGT 60.358 61.111 0.00 0.00 39.27 3.16
177 178 2.229589 CGATGCGACAGAGCTCAGC 61.230 63.158 17.77 15.47 38.13 4.26
197 198 1.556911 GTGATGAGGGATGTGGTGAGT 59.443 52.381 0.00 0.00 0.00 3.41
281 282 2.890474 GACGTGAATGCCGGCGAT 60.890 61.111 23.90 13.51 0.00 4.58
297 298 0.325671 AAGGAGGCGAGGATCTTGGA 60.326 55.000 0.00 0.00 0.00 3.53
531 533 3.215975 AGCTCTTCCTCTCCGTGTATAC 58.784 50.000 0.00 0.00 0.00 1.47
541 543 4.080975 CCTTCTTCATTGAGCTCTTCCTCT 60.081 45.833 16.19 0.00 33.02 3.69
552 554 2.158900 GGCTCGATCCCTTCTTCATTGA 60.159 50.000 0.00 0.00 0.00 2.57
636 638 0.949105 GACACCAATGCCTTCGACGT 60.949 55.000 0.00 0.00 0.00 4.34
647 649 3.632080 TGGTCCGGCGACACCAAT 61.632 61.111 23.25 0.00 39.85 3.16
765 767 2.809601 CACCGCCGTAGACAGTGC 60.810 66.667 0.00 0.00 0.00 4.40
830 850 6.530534 ACTCGGTAATTAAGATCAAACGACAG 59.469 38.462 0.00 0.00 0.00 3.51
880 900 2.330041 GTGCCAAACAACCCGTCG 59.670 61.111 0.00 0.00 0.00 5.12
908 928 2.138179 GGCGGCCATGTACTCCCTA 61.138 63.158 15.62 0.00 0.00 3.53
914 934 1.819632 CTTCCAGGCGGCCATGTAC 60.820 63.158 23.09 0.00 0.00 2.90
964 985 1.544825 CCGGGGTCGATGATGGCTAT 61.545 60.000 0.00 0.00 39.00 2.97
968 989 4.969196 CGCCGGGGTCGATGATGG 62.969 72.222 11.01 0.00 39.00 3.51
1486 3436 9.590451 CCTAACTATAGCTAGCTAGTAGTAGTG 57.410 40.741 28.20 22.87 30.41 2.74
1600 3780 0.324368 TGGGACTGTACCTCATCGCT 60.324 55.000 11.06 0.00 0.00 4.93
1605 3785 1.202964 TCGAGTTGGGACTGTACCTCA 60.203 52.381 11.06 0.00 35.88 3.86
1770 3951 3.909258 TTCGACGGGAAGCACGAGC 62.909 63.158 0.00 0.00 42.56 5.03
1775 3956 2.204461 TGGAGTTCGACGGGAAGCA 61.204 57.895 0.00 0.00 34.69 3.91
1920 4107 4.316823 TGGCTCCTGGAGGTCGGT 62.317 66.667 24.43 0.00 36.34 4.69
2060 4256 1.258445 ACCTCCCGTCCAGACATGAC 61.258 60.000 0.00 0.00 0.00 3.06
2136 4332 0.035439 AAATGACGCAATCCCCTCGT 60.035 50.000 0.00 0.00 39.33 4.18
2183 4380 1.941734 CGTCTCAGCCGCTCGAATC 60.942 63.158 0.00 0.00 0.00 2.52
2220 4417 2.281761 AGTCAACCGCAGCCAAGG 60.282 61.111 0.00 0.00 0.00 3.61
2232 4429 1.900351 CTGATCTGGCCCGAGTCAA 59.100 57.895 0.00 0.00 0.00 3.18
2278 4476 2.946785 CTCTAGGGGTCATCTACGGTT 58.053 52.381 0.00 0.00 0.00 4.44


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.