Multiple sequence alignment - TraesCS7D01G431900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G431900 chr7D 100.000 3416 0 0 1 3416 551605574 551602159 0.000000e+00 6309.0
1 TraesCS7D01G431900 chr7D 96.062 2006 63 11 5 2000 551501650 551499651 0.000000e+00 3253.0
2 TraesCS7D01G431900 chr7D 96.272 1395 44 4 2030 3416 551499654 551498260 0.000000e+00 2281.0
3 TraesCS7D01G431900 chr7D 84.696 1052 117 23 812 1839 551000535 550999504 0.000000e+00 1011.0
4 TraesCS7D01G431900 chr7D 83.056 903 110 22 2133 3026 550992032 550991164 0.000000e+00 780.0
5 TraesCS7D01G431900 chr7D 83.233 829 93 28 882 1688 551928641 551927837 0.000000e+00 719.0
6 TraesCS7D01G431900 chr7D 90.465 430 35 5 1 425 57537364 57536936 2.300000e-156 562.0
7 TraesCS7D01G431900 chr7B 92.061 1184 64 12 632 1800 596539322 596538154 0.000000e+00 1639.0
8 TraesCS7D01G431900 chr7B 92.169 1162 73 8 653 1800 596516475 596515318 0.000000e+00 1626.0
9 TraesCS7D01G431900 chr7B 93.087 1056 59 7 2081 3127 596501821 596500771 0.000000e+00 1533.0
10 TraesCS7D01G431900 chr7B 92.582 1038 62 8 1915 2942 596538103 596537071 0.000000e+00 1476.0
11 TraesCS7D01G431900 chr7B 91.981 823 52 8 2081 2896 596514977 596514162 0.000000e+00 1142.0
12 TraesCS7D01G431900 chr7B 86.246 967 101 16 811 1751 595882367 595881407 0.000000e+00 1020.0
13 TraesCS7D01G431900 chr7B 82.807 919 135 17 2133 3041 595948289 595949194 0.000000e+00 800.0
14 TraesCS7D01G431900 chr7B 82.174 920 114 28 2133 3041 595856394 595855514 0.000000e+00 745.0
15 TraesCS7D01G431900 chr7B 93.289 447 20 6 2977 3416 596537069 596536626 0.000000e+00 651.0
16 TraesCS7D01G431900 chr7B 92.874 435 24 6 2977 3405 596505947 596505514 2.890000e-175 625.0
17 TraesCS7D01G431900 chr7B 91.346 416 31 4 1 412 392823092 392823506 6.400000e-157 564.0
18 TraesCS7D01G431900 chr7B 81.293 727 107 15 2133 2850 595990315 595989609 2.300000e-156 562.0
19 TraesCS7D01G431900 chr7B 81.805 665 65 20 1190 1828 595993706 595993072 1.090000e-139 507.0
20 TraesCS7D01G431900 chr7B 90.578 329 13 7 1738 2060 596502284 596501968 1.470000e-113 420.0
21 TraesCS7D01G431900 chr7B 86.402 353 39 9 2690 3041 595951801 595952145 8.950000e-101 377.0
22 TraesCS7D01G431900 chr7B 85.387 349 44 7 2690 3037 595950027 595950369 4.190000e-94 355.0
23 TraesCS7D01G431900 chr7B 88.814 295 22 4 3122 3415 596419049 596418765 5.420000e-93 351.0
24 TraesCS7D01G431900 chr7B 93.878 147 8 1 1915 2060 596515267 596515121 1.600000e-53 220.0
25 TraesCS7D01G431900 chr7A 95.738 1009 35 3 858 1866 637158006 637157006 0.000000e+00 1618.0
26 TraesCS7D01G431900 chr7A 91.917 965 67 6 2149 3103 637151647 637150684 0.000000e+00 1339.0
27 TraesCS7D01G431900 chr7A 88.377 912 84 8 622 1524 637078320 637077422 0.000000e+00 1077.0
28 TraesCS7D01G431900 chr7A 82.898 918 110 21 2133 3041 636911318 636910439 0.000000e+00 782.0
29 TraesCS7D01G431900 chr7A 80.670 926 112 42 882 1772 637337031 637336138 0.000000e+00 656.0
30 TraesCS7D01G431900 chr7A 92.927 410 25 4 5 411 713734422 713734014 8.160000e-166 593.0
31 TraesCS7D01G431900 chr7A 95.146 309 11 3 1850 2157 637152057 637151752 5.130000e-133 484.0
32 TraesCS7D01G431900 chr7A 92.500 240 16 2 627 865 637172404 637172166 3.260000e-90 342.0
33 TraesCS7D01G431900 chr7A 85.902 305 31 5 812 1108 636920295 636919995 7.120000e-82 315.0
34 TraesCS7D01G431900 chr7A 85.185 135 14 5 460 593 677696417 677696288 2.140000e-27 134.0
35 TraesCS7D01G431900 chr7A 91.935 62 4 1 3029 3090 636910435 636910375 6.070000e-13 86.1
36 TraesCS7D01G431900 chr6D 91.971 411 29 3 6 412 266768873 266768463 1.060000e-159 573.0
37 TraesCS7D01G431900 chr6D 88.554 166 15 4 638 802 431160668 431160830 7.480000e-47 198.0
38 TraesCS7D01G431900 chr3D 91.971 411 28 3 6 411 512532212 512531802 3.820000e-159 571.0
39 TraesCS7D01G431900 chr3D 88.415 164 16 3 635 797 87925997 87926158 9.670000e-46 195.0
40 TraesCS7D01G431900 chr3D 91.228 114 8 2 468 581 553037749 553037860 1.640000e-33 154.0
41 TraesCS7D01G431900 chr3D 90.351 114 9 2 468 581 553071061 553071172 7.640000e-32 148.0
42 TraesCS7D01G431900 chr3D 90.351 114 9 2 468 581 553076262 553076373 7.640000e-32 148.0
43 TraesCS7D01G431900 chr2D 91.367 417 28 8 3 412 45481720 45481305 6.400000e-157 564.0
44 TraesCS7D01G431900 chr1D 90.654 428 33 6 1 423 468044399 468044824 2.300000e-156 562.0
45 TraesCS7D01G431900 chr1D 90.714 420 29 7 1 416 426648381 426647968 4.980000e-153 551.0
46 TraesCS7D01G431900 chr2A 88.485 165 15 4 637 800 367649322 367649161 2.690000e-46 196.0
47 TraesCS7D01G431900 chr6B 87.574 169 17 4 635 801 256326137 256326303 3.480000e-45 193.0
48 TraesCS7D01G431900 chr6B 89.474 114 11 1 468 581 256326137 256326249 3.550000e-30 143.0
49 TraesCS7D01G431900 chr4D 88.344 163 16 3 636 797 386984666 386984826 3.480000e-45 193.0
50 TraesCS7D01G431900 chr2B 86.932 176 18 5 629 802 249200335 249200163 3.480000e-45 193.0
51 TraesCS7D01G431900 chr2B 92.661 109 6 2 482 590 378686921 378686815 4.560000e-34 156.0
52 TraesCS7D01G431900 chr2B 90.265 113 11 0 469 581 582961483 582961371 7.640000e-32 148.0
53 TraesCS7D01G431900 chr3B 86.992 123 15 1 466 588 11102454 11102575 1.650000e-28 137.0
54 TraesCS7D01G431900 chr4A 79.167 144 29 1 285 428 426660579 426660437 7.800000e-17 99.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G431900 chr7D 551602159 551605574 3415 True 6309.000000 6309 100.000000 1 3416 1 chr7D.!!$R4 3415
1 TraesCS7D01G431900 chr7D 551498260 551501650 3390 True 2767.000000 3253 96.167000 5 3416 2 chr7D.!!$R6 3411
2 TraesCS7D01G431900 chr7D 550999504 551000535 1031 True 1011.000000 1011 84.696000 812 1839 1 chr7D.!!$R3 1027
3 TraesCS7D01G431900 chr7D 550991164 550992032 868 True 780.000000 780 83.056000 2133 3026 1 chr7D.!!$R2 893
4 TraesCS7D01G431900 chr7D 551927837 551928641 804 True 719.000000 719 83.233000 882 1688 1 chr7D.!!$R5 806
5 TraesCS7D01G431900 chr7B 596536626 596539322 2696 True 1255.333333 1639 92.644000 632 3416 3 chr7B.!!$R7 2784
6 TraesCS7D01G431900 chr7B 595881407 595882367 960 True 1020.000000 1020 86.246000 811 1751 1 chr7B.!!$R2 940
7 TraesCS7D01G431900 chr7B 596514162 596516475 2313 True 996.000000 1626 92.676000 653 2896 3 chr7B.!!$R6 2243
8 TraesCS7D01G431900 chr7B 596500771 596505947 5176 True 859.333333 1533 92.179667 1738 3405 3 chr7B.!!$R5 1667
9 TraesCS7D01G431900 chr7B 595855514 595856394 880 True 745.000000 745 82.174000 2133 3041 1 chr7B.!!$R1 908
10 TraesCS7D01G431900 chr7B 595989609 595993706 4097 True 534.500000 562 81.549000 1190 2850 2 chr7B.!!$R4 1660
11 TraesCS7D01G431900 chr7B 595948289 595952145 3856 False 510.666667 800 84.865333 2133 3041 3 chr7B.!!$F2 908
12 TraesCS7D01G431900 chr7A 637157006 637158006 1000 True 1618.000000 1618 95.738000 858 1866 1 chr7A.!!$R3 1008
13 TraesCS7D01G431900 chr7A 637077422 637078320 898 True 1077.000000 1077 88.377000 622 1524 1 chr7A.!!$R2 902
14 TraesCS7D01G431900 chr7A 637150684 637152057 1373 True 911.500000 1339 93.531500 1850 3103 2 chr7A.!!$R9 1253
15 TraesCS7D01G431900 chr7A 637336138 637337031 893 True 656.000000 656 80.670000 882 1772 1 chr7A.!!$R5 890
16 TraesCS7D01G431900 chr7A 636910375 636911318 943 True 434.050000 782 87.416500 2133 3090 2 chr7A.!!$R8 957

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
259 263 0.613777 ACCCCGTGAATCAAGAGGTC 59.386 55.000 0.0 0.0 0.00 3.85 F
401 405 1.365633 GATGCGGGGTCTGCTAGAG 59.634 63.158 0.0 0.0 0.00 2.43 F
554 559 4.331168 AGCAAAATGAGTGAATCTACGCTC 59.669 41.667 0.0 0.0 44.55 5.03 F
1959 4568 5.818678 ATATAGAAATGCGGTTCCCAGTA 57.181 39.130 0.0 0.0 0.00 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1579 1631 1.137086 CGGATCTTGGATCGGTGACTT 59.863 52.381 0.00 0.0 0.00 3.01 R
1959 4568 4.141937 TGCCTTCGTACTAAGCATCTCAAT 60.142 41.667 1.63 0.0 0.00 2.57 R
2364 7008 4.396478 GCCCTCTTCAATGAAAGAAGTACC 59.604 45.833 0.00 0.0 42.35 3.34 R
2782 8024 1.959985 TGGACCAAAACAACATGCGAT 59.040 42.857 0.00 0.0 0.00 4.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
206 210 2.897350 CCCTCCGCCAAATCTCGC 60.897 66.667 0.00 0.00 0.00 5.03
229 233 2.525381 ATAGGGGCTGAGCTCGGG 60.525 66.667 23.87 12.90 0.00 5.14
259 263 0.613777 ACCCCGTGAATCAAGAGGTC 59.386 55.000 0.00 0.00 0.00 3.85
282 286 3.440356 GAGATCTTTTGCCGCGCCG 62.440 63.158 0.00 0.00 0.00 6.46
331 335 2.501128 CGGTGTCTGATCGGGCAT 59.499 61.111 12.91 0.00 0.00 4.40
401 405 1.365633 GATGCGGGGTCTGCTAGAG 59.634 63.158 0.00 0.00 0.00 2.43
477 482 9.436957 ACAAAAAGGTATATAGATATGCTTCCG 57.563 33.333 0.00 0.00 0.00 4.30
496 501 6.563567 GCTTCCGCCGTTCTTAAATATAAGTC 60.564 42.308 0.00 0.00 39.65 3.01
551 556 5.352569 AGGAAGCAAAATGAGTGAATCTACG 59.647 40.000 0.00 0.00 0.00 3.51
552 557 4.606457 AGCAAAATGAGTGAATCTACGC 57.394 40.909 0.00 0.00 0.00 4.42
554 559 4.331168 AGCAAAATGAGTGAATCTACGCTC 59.669 41.667 0.00 0.00 44.55 5.03
696 704 8.234136 AGACTTCAATAATGGACTACATACGA 57.766 34.615 0.00 0.00 39.40 3.43
716 724 9.888878 CATACGAAGCAAAATGAATGAATCTAT 57.111 29.630 0.00 0.00 0.00 1.98
1948 3891 7.017645 CGCTATGTTGTCCAATATAGAAATGC 58.982 38.462 21.07 9.86 41.89 3.56
1959 4568 5.818678 ATATAGAAATGCGGTTCCCAGTA 57.181 39.130 0.00 0.00 0.00 2.74
2226 6865 9.659830 GAACTAATCGACACATTTAACAGTTTT 57.340 29.630 0.00 0.00 0.00 2.43
2544 7193 2.226330 TGGATCACAAACCTTTGGTCG 58.774 47.619 2.94 0.00 42.34 4.79
3265 10902 2.425143 ATGTGTCCACCCATGTCATC 57.575 50.000 0.00 0.00 0.00 2.92
3389 11028 2.227626 TGCCATGTAAACACAACATCCG 59.772 45.455 0.00 0.00 35.39 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 65 2.348998 CTGCTGTCCCCTGTCACC 59.651 66.667 0.00 0.00 0.00 4.02
68 71 2.284995 GACTCCCTGCTGTCCCCT 60.285 66.667 0.00 0.00 0.00 4.79
108 111 3.740128 CTCCGGTGCATCTTCCCCG 62.740 68.421 0.00 4.30 40.12 5.73
112 115 2.125512 ACGCTCCGGTGCATCTTC 60.126 61.111 26.64 0.00 0.00 2.87
177 180 3.202706 GGAGGGACATTTCCGCGC 61.203 66.667 0.00 0.00 43.94 6.86
195 199 0.880278 TATCCGCAGCGAGATTTGGC 60.880 55.000 18.75 0.00 0.00 4.52
206 210 2.739784 CTCAGCCCCTATCCGCAG 59.260 66.667 0.00 0.00 0.00 5.18
220 224 2.750637 GAGGACGACCCGAGCTCA 60.751 66.667 15.40 0.00 40.87 4.26
259 263 1.819632 CGGCAAAAGATCTCCCCCG 60.820 63.158 0.00 2.66 0.00 5.73
313 317 3.094062 ATGCCCGATCAGACACCGG 62.094 63.158 0.00 0.00 42.64 5.28
331 335 2.522193 GGTTGGGGCGGGAAAACA 60.522 61.111 0.00 0.00 0.00 2.83
1579 1631 1.137086 CGGATCTTGGATCGGTGACTT 59.863 52.381 0.00 0.00 0.00 3.01
1959 4568 4.141937 TGCCTTCGTACTAAGCATCTCAAT 60.142 41.667 1.63 0.00 0.00 2.57
2364 7008 4.396478 GCCCTCTTCAATGAAAGAAGTACC 59.604 45.833 0.00 0.00 42.35 3.34
2655 7308 2.034053 GTCCGAAACTCCAAACATGCAA 59.966 45.455 0.00 0.00 0.00 4.08
2782 8024 1.959985 TGGACCAAAACAACATGCGAT 59.040 42.857 0.00 0.00 0.00 4.58
3265 10902 5.120208 CCTCCACATCTATTTATAAACCGCG 59.880 44.000 0.00 0.00 0.00 6.46
3389 11028 4.251268 AGTTTTTGTCCATACGCTCCTAC 58.749 43.478 0.00 0.00 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.