Multiple sequence alignment - TraesCS7D01G426100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G426100 chr7D 100.000 2285 0 0 1 2285 546125811 546128095 0.000000e+00 4220.0
1 TraesCS7D01G426100 chr7D 92.683 205 15 0 2081 2285 545656791 545656587 1.720000e-76 296.0
2 TraesCS7D01G426100 chr7D 92.683 205 15 0 2081 2285 545662074 545661870 1.720000e-76 296.0
3 TraesCS7D01G426100 chr7A 95.875 2303 73 12 2 2285 628863125 628865424 0.000000e+00 3707.0
4 TraesCS7D01G426100 chr7A 93.171 205 14 0 2081 2285 628655206 628655002 3.690000e-78 302.0
5 TraesCS7D01G426100 chr7A 85.141 249 23 11 393 630 628839566 628839811 2.270000e-60 243.0
6 TraesCS7D01G426100 chr7A 88.824 170 19 0 2111 2280 169950960 169951129 2.300000e-50 209.0
7 TraesCS7D01G426100 chr7A 83.744 203 20 5 533 722 628863857 628864059 1.800000e-41 180.0
8 TraesCS7D01G426100 chr7A 84.699 183 18 6 738 920 628863687 628863859 8.390000e-40 174.0
9 TraesCS7D01G426100 chr7B 94.217 2317 98 13 1 2283 590103393 590105707 0.000000e+00 3504.0
10 TraesCS7D01G426100 chr7B 91.133 203 17 1 2081 2283 589943326 589943125 8.040000e-70 274.0
11 TraesCS7D01G426100 chr7B 88.506 174 20 0 2112 2285 589901162 589900989 6.400000e-51 211.0
12 TraesCS7D01G426100 chr6A 81.679 786 137 6 1033 1813 98914148 98914931 0.000000e+00 647.0
13 TraesCS7D01G426100 chr6A 78.976 918 178 12 955 1863 98061801 98062712 1.500000e-171 612.0
14 TraesCS7D01G426100 chr6D 81.401 785 141 4 1033 1813 82206706 82207489 8.900000e-179 636.0
15 TraesCS7D01G426100 chr6D 78.812 892 178 10 979 1863 81670746 81671633 7.030000e-165 590.0
16 TraesCS7D01G426100 chr6B 81.194 787 139 8 1033 1813 156525845 156526628 1.930000e-175 625.0
17 TraesCS7D01G426100 chr6B 78.867 918 179 13 955 1863 156372864 156373775 6.980000e-170 606.0
18 TraesCS7D01G426100 chr3B 81.356 177 30 3 719 895 103907090 103906917 8.510000e-30 141.0
19 TraesCS7D01G426100 chr3B 79.459 185 27 9 523 697 103907100 103906917 1.110000e-23 121.0
20 TraesCS7D01G426100 chr2D 80.347 173 20 8 721 883 599455375 599455207 3.990000e-23 119.0
21 TraesCS7D01G426100 chr2D 90.385 52 4 1 716 767 31747959 31748009 1.460000e-07 67.6
22 TraesCS7D01G426100 chr2B 88.462 52 5 1 716 767 51884519 51884569 6.820000e-06 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G426100 chr7D 546125811 546128095 2284 False 4220.000000 4220 100.000 1 2285 1 chr7D.!!$F1 2284
1 TraesCS7D01G426100 chr7A 628863125 628865424 2299 False 1353.666667 3707 88.106 2 2285 3 chr7A.!!$F3 2283
2 TraesCS7D01G426100 chr7B 590103393 590105707 2314 False 3504.000000 3504 94.217 1 2283 1 chr7B.!!$F1 2282
3 TraesCS7D01G426100 chr6A 98914148 98914931 783 False 647.000000 647 81.679 1033 1813 1 chr6A.!!$F2 780
4 TraesCS7D01G426100 chr6A 98061801 98062712 911 False 612.000000 612 78.976 955 1863 1 chr6A.!!$F1 908
5 TraesCS7D01G426100 chr6D 82206706 82207489 783 False 636.000000 636 81.401 1033 1813 1 chr6D.!!$F2 780
6 TraesCS7D01G426100 chr6D 81670746 81671633 887 False 590.000000 590 78.812 979 1863 1 chr6D.!!$F1 884
7 TraesCS7D01G426100 chr6B 156525845 156526628 783 False 625.000000 625 81.194 1033 1813 1 chr6B.!!$F2 780
8 TraesCS7D01G426100 chr6B 156372864 156373775 911 False 606.000000 606 78.867 955 1863 1 chr6B.!!$F1 908

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
40 41 0.667184 GATTTGGTTGTTGCTGGCGG 60.667 55.0 0.0 0.0 0.0 6.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1979 2021 0.108138 GCTGGGACGTCTGCTTATGT 60.108 55.0 16.46 0.0 0.0 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 0.667184 GATTTGGTTGTTGCTGGCGG 60.667 55.000 0.00 0.00 0.00 6.13
53 54 2.194597 GGCGGTGCCCATCCATTA 59.805 61.111 0.00 0.00 44.06 1.90
54 55 1.898574 GGCGGTGCCCATCCATTAG 60.899 63.158 0.00 0.00 44.06 1.73
67 70 0.679640 CCATTAGCTTTCGGTGCCCA 60.680 55.000 0.00 0.00 0.00 5.36
258 285 1.308783 GGCAGCAGTTAGGACTTGGC 61.309 60.000 0.00 0.00 33.71 4.52
279 306 4.826600 GCCATATGCGCGTGATTC 57.173 55.556 13.61 0.00 0.00 2.52
288 315 1.687494 GCGCGTGATTCTGGTCTCAC 61.687 60.000 8.43 0.00 38.69 3.51
354 386 3.665745 AATGTTGGACTTCCATGTTGC 57.334 42.857 0.00 0.00 46.97 4.17
379 411 4.434857 CGCCTTTCTCAGAGAAATCGAAAC 60.435 45.833 27.20 14.42 42.66 2.78
398 430 7.087007 TCGAAACTATTCTGCTAGCATATCAG 58.913 38.462 19.72 15.18 36.20 2.90
512 545 5.162000 ACTTTCTCTTTTCTCAAACAGCG 57.838 39.130 0.00 0.00 0.00 5.18
554 587 3.061322 CACTTTCCGTAATCGTGGAACA 58.939 45.455 0.00 0.00 43.68 3.18
556 589 3.006110 ACTTTCCGTAATCGTGGAACAGA 59.994 43.478 0.00 0.00 43.68 3.41
637 672 4.087907 ACTACGAGCCTTTTTCCTACTCT 58.912 43.478 0.00 0.00 0.00 3.24
731 766 4.261031 GCGCAAGAATACCATTTTCCGTAT 60.261 41.667 0.30 0.00 43.02 3.06
886 925 8.647796 TGTTAGAAAACAATCCTTCTACTCAGA 58.352 33.333 0.00 0.00 42.60 3.27
925 964 3.508845 AGCACAAGATTACCACCTGTT 57.491 42.857 0.00 0.00 0.00 3.16
1677 1719 2.749076 TGCGGTGAATTCTCTTTCCATG 59.251 45.455 7.05 0.00 0.00 3.66
1905 1947 2.745821 GCACAAGTCATCTGATGCAGAA 59.254 45.455 12.78 0.00 44.04 3.02
1979 2021 3.711704 ACAGAGTTTGTTCTTCTGAGGGA 59.288 43.478 7.64 0.00 36.31 4.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 1.334869 CGAAAGCTAATGGATGGGCAC 59.665 52.381 0.00 0.00 0.00 5.01
44 45 1.334869 GCACCGAAAGCTAATGGATGG 59.665 52.381 5.15 0.00 0.00 3.51
45 46 1.334869 GGCACCGAAAGCTAATGGATG 59.665 52.381 5.15 2.01 0.00 3.51
46 47 1.680338 GGCACCGAAAGCTAATGGAT 58.320 50.000 5.15 0.00 0.00 3.41
48 49 2.106844 GGGCACCGAAAGCTAATGG 58.893 57.895 0.00 0.00 40.86 3.16
67 70 0.258774 AGGCGGGTTTGCTAATGGAT 59.741 50.000 0.00 0.00 34.52 3.41
258 285 0.308684 ATCACGCGCATATGGCTTTG 59.691 50.000 5.73 6.59 41.67 2.77
279 306 6.684686 ACATTGAATTCATTTGTGAGACCAG 58.315 36.000 18.60 1.37 0.00 4.00
288 315 9.642327 TTGTTCCTATGACATTGAATTCATTTG 57.358 29.630 9.40 12.42 34.28 2.32
354 386 1.325943 GATTTCTCTGAGAAAGGCGCG 59.674 52.381 29.91 0.00 46.15 6.86
398 430 2.472816 CAAAACACAGTGGGAACATGC 58.527 47.619 0.00 0.00 46.14 4.06
554 587 4.322567 GAAACATTTCAGCTCCAGACTCT 58.677 43.478 0.00 0.00 37.15 3.24
556 589 3.181440 TGGAAACATTTCAGCTCCAGACT 60.181 43.478 6.68 0.00 38.92 3.24
630 664 5.807520 CAGTTATGTGTGTAAGCAGAGTAGG 59.192 44.000 0.00 0.00 0.00 3.18
637 672 7.737972 AATTGTACAGTTATGTGTGTAAGCA 57.262 32.000 1.14 0.00 40.79 3.91
731 766 1.986631 TCCAAACTCGGTTCCCCAATA 59.013 47.619 0.00 0.00 0.00 1.90
838 877 4.381863 CAGATTGTACAGTCGTGTGTGTAC 59.618 45.833 12.18 5.82 46.20 2.90
886 925 5.046591 TGTGCTTTGCTAGACTAGGTGTAAT 60.047 40.000 11.48 0.00 0.00 1.89
925 964 9.538508 GGAAGTGTAGTTAAAAGTAGAACAGAA 57.461 33.333 0.00 0.00 0.00 3.02
1017 1056 4.574421 TGCAAGTGTATCAACCATAATCCG 59.426 41.667 0.00 0.00 0.00 4.18
1677 1719 1.126846 CTCAACGGCGAAATGTGTCTC 59.873 52.381 16.62 0.00 0.00 3.36
1905 1947 5.812642 CGACATAGAGGCAAGTTCATTTACT 59.187 40.000 0.00 0.00 0.00 2.24
1979 2021 0.108138 GCTGGGACGTCTGCTTATGT 60.108 55.000 16.46 0.00 0.00 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.