Multiple sequence alignment - TraesCS7D01G418400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G418400 chr7D 100.000 3408 0 0 1 3408 538117375 538113968 0 6294
1 TraesCS7D01G418400 chr7D 98.984 1674 16 1 1736 3408 621833095 621831422 0 2996
2 TraesCS7D01G418400 chr7D 98.333 1680 26 2 1730 3408 120904399 120906077 0 2946
3 TraesCS7D01G418400 chr7D 99.108 1121 9 1 1 1120 434200315 434201435 0 2013
4 TraesCS7D01G418400 chr7D 98.864 616 7 0 1116 1731 627254438 627253823 0 1099
5 TraesCS7D01G418400 chr7D 87.346 893 78 26 2520 3408 565829913 565829052 0 990
6 TraesCS7D01G418400 chr2D 98.929 1680 17 1 1730 3408 292182447 292184126 0 3001
7 TraesCS7D01G418400 chr2D 98.208 1674 16 3 1736 3408 212892094 212890434 0 2913
8 TraesCS7D01G418400 chr2D 97.738 1680 28 3 1730 3408 161796659 161798329 0 2883
9 TraesCS7D01G418400 chr2D 92.735 1693 86 30 1730 3403 89006142 89007816 0 2410
10 TraesCS7D01G418400 chr2D 98.930 1122 10 2 1 1120 67587035 67588156 0 2004
11 TraesCS7D01G418400 chr2D 98.930 1121 11 1 1 1120 70696914 70698034 0 2002
12 TraesCS7D01G418400 chr2D 98.841 1122 11 2 1 1120 260342909 260344030 0 1999
13 TraesCS7D01G418400 chr2D 98.706 618 8 0 1114 1731 336021018 336021635 0 1098
14 TraesCS7D01G418400 chr4D 98.626 1674 19 2 1736 3408 76309204 76307534 0 2961
15 TraesCS7D01G418400 chr4D 98.840 1121 12 1 1 1120 106031131 106030011 0 1997
16 TraesCS7D01G418400 chr1D 96.184 1677 58 6 1736 3408 393883843 393882169 0 2737
17 TraesCS7D01G418400 chr1D 98.864 616 7 0 1116 1731 43775761 43775146 0 1099
18 TraesCS7D01G418400 chr1D 98.864 616 6 1 1116 1731 393885051 393884437 0 1098
19 TraesCS7D01G418400 chr3D 96.014 1681 32 27 1736 3403 65620620 65618962 0 2700
20 TraesCS7D01G418400 chr3D 98.864 616 7 0 1116 1731 5999299 5998684 0 1099
21 TraesCS7D01G418400 chr3D 98.864 616 7 0 1116 1731 157513005 157512390 0 1099
22 TraesCS7D01G418400 chr3D 98.864 616 7 0 1116 1731 230854151 230854766 0 1099
23 TraesCS7D01G418400 chr6D 92.929 1683 84 28 1736 3403 429679208 429677546 0 2416
24 TraesCS7D01G418400 chr6D 88.843 726 68 10 2689 3408 315873886 315873168 0 880
25 TraesCS7D01G418400 chrUn 99.107 1120 7 2 2 1120 131132062 131130945 0 2010
26 TraesCS7D01G418400 chrUn 99.107 1120 7 2 2 1120 363728111 363729228 0 2010
27 TraesCS7D01G418400 chrUn 98.864 616 7 0 1116 1731 9781182 9780567 0 1099
28 TraesCS7D01G418400 chr5D 98.841 1122 11 2 1 1120 242877082 242875961 0 1999
29 TraesCS7D01G418400 chr5D 98.841 1122 11 2 1 1120 356958576 356957455 0 1999
30 TraesCS7D01G418400 chr5D 98.864 616 7 0 1116 1731 94895691 94896306 0 1099


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G418400 chr7D 538113968 538117375 3407 True 6294.0 6294 100.000 1 3408 1 chr7D.!!$R1 3407
1 TraesCS7D01G418400 chr7D 621831422 621833095 1673 True 2996.0 2996 98.984 1736 3408 1 chr7D.!!$R3 1672
2 TraesCS7D01G418400 chr7D 120904399 120906077 1678 False 2946.0 2946 98.333 1730 3408 1 chr7D.!!$F1 1678
3 TraesCS7D01G418400 chr7D 434200315 434201435 1120 False 2013.0 2013 99.108 1 1120 1 chr7D.!!$F2 1119
4 TraesCS7D01G418400 chr7D 627253823 627254438 615 True 1099.0 1099 98.864 1116 1731 1 chr7D.!!$R4 615
5 TraesCS7D01G418400 chr7D 565829052 565829913 861 True 990.0 990 87.346 2520 3408 1 chr7D.!!$R2 888
6 TraesCS7D01G418400 chr2D 292182447 292184126 1679 False 3001.0 3001 98.929 1730 3408 1 chr2D.!!$F6 1678
7 TraesCS7D01G418400 chr2D 212890434 212892094 1660 True 2913.0 2913 98.208 1736 3408 1 chr2D.!!$R1 1672
8 TraesCS7D01G418400 chr2D 161796659 161798329 1670 False 2883.0 2883 97.738 1730 3408 1 chr2D.!!$F4 1678
9 TraesCS7D01G418400 chr2D 89006142 89007816 1674 False 2410.0 2410 92.735 1730 3403 1 chr2D.!!$F3 1673
10 TraesCS7D01G418400 chr2D 67587035 67588156 1121 False 2004.0 2004 98.930 1 1120 1 chr2D.!!$F1 1119
11 TraesCS7D01G418400 chr2D 70696914 70698034 1120 False 2002.0 2002 98.930 1 1120 1 chr2D.!!$F2 1119
12 TraesCS7D01G418400 chr2D 260342909 260344030 1121 False 1999.0 1999 98.841 1 1120 1 chr2D.!!$F5 1119
13 TraesCS7D01G418400 chr2D 336021018 336021635 617 False 1098.0 1098 98.706 1114 1731 1 chr2D.!!$F7 617
14 TraesCS7D01G418400 chr4D 76307534 76309204 1670 True 2961.0 2961 98.626 1736 3408 1 chr4D.!!$R1 1672
15 TraesCS7D01G418400 chr4D 106030011 106031131 1120 True 1997.0 1997 98.840 1 1120 1 chr4D.!!$R2 1119
16 TraesCS7D01G418400 chr1D 393882169 393885051 2882 True 1917.5 2737 97.524 1116 3408 2 chr1D.!!$R2 2292
17 TraesCS7D01G418400 chr1D 43775146 43775761 615 True 1099.0 1099 98.864 1116 1731 1 chr1D.!!$R1 615
18 TraesCS7D01G418400 chr3D 65618962 65620620 1658 True 2700.0 2700 96.014 1736 3403 1 chr3D.!!$R2 1667
19 TraesCS7D01G418400 chr3D 5998684 5999299 615 True 1099.0 1099 98.864 1116 1731 1 chr3D.!!$R1 615
20 TraesCS7D01G418400 chr3D 157512390 157513005 615 True 1099.0 1099 98.864 1116 1731 1 chr3D.!!$R3 615
21 TraesCS7D01G418400 chr3D 230854151 230854766 615 False 1099.0 1099 98.864 1116 1731 1 chr3D.!!$F1 615
22 TraesCS7D01G418400 chr6D 429677546 429679208 1662 True 2416.0 2416 92.929 1736 3403 1 chr6D.!!$R2 1667
23 TraesCS7D01G418400 chr6D 315873168 315873886 718 True 880.0 880 88.843 2689 3408 1 chr6D.!!$R1 719
24 TraesCS7D01G418400 chrUn 131130945 131132062 1117 True 2010.0 2010 99.107 2 1120 1 chrUn.!!$R2 1118
25 TraesCS7D01G418400 chrUn 363728111 363729228 1117 False 2010.0 2010 99.107 2 1120 1 chrUn.!!$F1 1118
26 TraesCS7D01G418400 chrUn 9780567 9781182 615 True 1099.0 1099 98.864 1116 1731 1 chrUn.!!$R1 615
27 TraesCS7D01G418400 chr5D 242875961 242877082 1121 True 1999.0 1999 98.841 1 1120 1 chr5D.!!$R1 1119
28 TraesCS7D01G418400 chr5D 356957455 356958576 1121 True 1999.0 1999 98.841 1 1120 1 chr5D.!!$R2 1119
29 TraesCS7D01G418400 chr5D 94895691 94896306 615 False 1099.0 1099 98.864 1116 1731 1 chr5D.!!$F1 615

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
843 845 0.321210 TCGGATGGTGTTGCGTGAAT 60.321 50.000 0.0 0.0 0.0 2.57 F
1598 1602 1.741706 CGCCTACTCCAGAACTTACGA 59.258 52.381 0.0 0.0 0.0 3.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1731 2324 2.698797 GGATAAGTCCATCTCCAACGGA 59.301 50.000 0.0 0.0 44.42 4.69 R
2729 3505 7.284034 AGCTAACTTAGGTGAAATGGATCATTG 59.716 37.037 0.0 0.0 33.00 2.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
89 90 1.082366 CTGTTTACGGTGCGGCAAC 60.082 57.895 8.25 8.25 0.00 4.17
806 808 3.744942 CGAACTAGATGCAGATGGGAATG 59.255 47.826 0.00 0.00 0.00 2.67
841 843 1.018752 CATCGGATGGTGTTGCGTGA 61.019 55.000 10.18 0.00 0.00 4.35
843 845 0.321210 TCGGATGGTGTTGCGTGAAT 60.321 50.000 0.00 0.00 0.00 2.57
1171 1175 4.633175 TGTACCTTCTGCATTCACGTTTA 58.367 39.130 0.00 0.00 0.00 2.01
1177 1181 5.796935 CCTTCTGCATTCACGTTTATTCAAG 59.203 40.000 0.00 0.00 0.00 3.02
1519 1523 6.028368 GTCTCATTTGATTGCAGACATTCTG 58.972 40.000 0.00 0.00 46.90 3.02
1598 1602 1.741706 CGCCTACTCCAGAACTTACGA 59.258 52.381 0.00 0.00 0.00 3.43
1655 1659 1.810151 GCCTTGCGTGGTATCAAGAAA 59.190 47.619 3.79 0.00 41.50 2.52
1731 2324 9.226879 AGGTAATTCTTAAGGCCTTCTACTTAT 57.773 33.333 24.49 6.60 0.00 1.73
1734 2327 5.786264 TCTTAAGGCCTTCTACTTATCCG 57.214 43.478 24.49 0.00 0.00 4.18
2288 2881 8.730680 ACATTACTTGCTAGTCTTAACATTTGG 58.269 33.333 3.45 0.00 35.78 3.28
2614 3389 9.238368 CATTTCACCTAGGTTAACTCCAAAATA 57.762 33.333 13.15 0.00 0.00 1.40
2626 3401 9.016438 GTTAACTCCAAAATAACCCATCTTACA 57.984 33.333 0.00 0.00 0.00 2.41
2653 3428 8.383318 AGGTTATCTCATAAACGATCCATTTG 57.617 34.615 0.00 0.00 37.51 2.32
2729 3505 7.865706 TCCATTTCACCTAAATTAGCTCTTC 57.134 36.000 0.00 0.00 35.54 2.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
89 90 1.339535 GCCTCTGTCCTCTTTTCCCAG 60.340 57.143 0.00 0.00 0.00 4.45
806 808 4.180817 TCCGATGTGTGTACAATCATCAC 58.819 43.478 26.51 18.49 40.84 3.06
1171 1175 4.142469 GGCCAACGCATTAGTTACTTGAAT 60.142 41.667 0.00 0.00 36.38 2.57
1177 1181 2.486592 ACAAGGCCAACGCATTAGTTAC 59.513 45.455 5.01 0.00 36.73 2.50
1519 1523 0.466124 GTATCCCTCCTCACACCTGC 59.534 60.000 0.00 0.00 0.00 4.85
1731 2324 2.698797 GGATAAGTCCATCTCCAACGGA 59.301 50.000 0.00 0.00 44.42 4.69
1734 2327 3.821421 ACGGATAAGTCCATCTCCAAC 57.179 47.619 0.00 0.00 45.37 3.77
2288 2881 4.430007 TGTCTCGTTAGCATTATGACACC 58.570 43.478 0.00 0.00 0.00 4.16
2614 3389 7.931015 TGAGATAACCTATGTAAGATGGGTT 57.069 36.000 9.19 9.19 43.76 4.11
2653 3428 9.042008 TGGATCGTTTATGAGCTAAATTAGTTC 57.958 33.333 9.51 9.51 36.67 3.01
2729 3505 7.284034 AGCTAACTTAGGTGAAATGGATCATTG 59.716 37.037 0.00 0.00 33.00 2.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.