Multiple sequence alignment - TraesCS7D01G408900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G408900 chr7D 100.000 2524 0 0 1 2524 527459387 527456864 0.000000e+00 4662.0
1 TraesCS7D01G408900 chr7D 97.624 2525 56 4 1 2524 527189016 527186495 0.000000e+00 4327.0
2 TraesCS7D01G408900 chr7D 96.758 2529 70 5 1 2524 526962927 526960406 0.000000e+00 4205.0
3 TraesCS7D01G408900 chr7D 95.525 2525 110 3 2 2524 526789759 526787236 0.000000e+00 4034.0
4 TraesCS7D01G408900 chr7D 92.451 1987 118 15 1 1982 232116327 232114368 0.000000e+00 2809.0
5 TraesCS7D01G408900 chr7D 93.376 468 31 0 2057 2524 526777357 526776890 0.000000e+00 693.0
6 TraesCS7D01G408900 chr3D 93.076 1993 110 13 1 1984 559037703 559035730 0.000000e+00 2891.0
7 TraesCS7D01G408900 chr4B 91.151 1989 142 12 1 1981 122823002 122824964 0.000000e+00 2667.0
8 TraesCS7D01G408900 chr3B 90.559 1663 128 18 343 1984 416491569 416493223 0.000000e+00 2174.0
9 TraesCS7D01G408900 chr3B 90.565 1611 130 13 377 1982 249946708 249948301 0.000000e+00 2113.0
10 TraesCS7D01G408900 chr3B 94.017 234 11 3 61 293 416491339 416491570 3.990000e-93 351.0
11 TraesCS7D01G408900 chr3B 89.007 282 21 7 1 276 249946405 249946682 8.650000e-90 340.0
12 TraesCS7D01G408900 chr3B 92.469 239 14 2 1 237 249946249 249946485 3.110000e-89 339.0
13 TraesCS7D01G408900 chr3B 86.851 289 28 7 1 286 72158013 72158294 5.240000e-82 315.0
14 TraesCS7D01G408900 chr3B 86.458 288 38 1 1695 1981 601370912 601370625 5.240000e-82 315.0
15 TraesCS7D01G408900 chr4A 89.359 1701 141 12 131 1799 201184329 201186021 0.000000e+00 2102.0
16 TraesCS7D01G408900 chr1D 92.964 469 32 1 2055 2523 75651616 75651149 0.000000e+00 682.0
17 TraesCS7D01G408900 chr1D 92.934 467 31 2 2059 2524 123049952 123050417 0.000000e+00 678.0
18 TraesCS7D01G408900 chr1D 92.735 468 34 0 2057 2524 257246180 257246647 0.000000e+00 676.0
19 TraesCS7D01G408900 chr4D 92.600 473 35 0 2052 2524 391103316 391103788 0.000000e+00 680.0
20 TraesCS7D01G408900 chr6D 92.751 469 33 1 2057 2524 285914965 285915433 0.000000e+00 676.0
21 TraesCS7D01G408900 chr5A 88.679 53 3 3 2001 2053 9592298 9592249 7.540000e-06 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G408900 chr7D 527456864 527459387 2523 True 4662.000000 4662 100.000000 1 2524 1 chr7D.!!$R6 2523
1 TraesCS7D01G408900 chr7D 527186495 527189016 2521 True 4327.000000 4327 97.624000 1 2524 1 chr7D.!!$R5 2523
2 TraesCS7D01G408900 chr7D 526960406 526962927 2521 True 4205.000000 4205 96.758000 1 2524 1 chr7D.!!$R4 2523
3 TraesCS7D01G408900 chr7D 526787236 526789759 2523 True 4034.000000 4034 95.525000 2 2524 1 chr7D.!!$R3 2522
4 TraesCS7D01G408900 chr7D 232114368 232116327 1959 True 2809.000000 2809 92.451000 1 1982 1 chr7D.!!$R1 1981
5 TraesCS7D01G408900 chr3D 559035730 559037703 1973 True 2891.000000 2891 93.076000 1 1984 1 chr3D.!!$R1 1983
6 TraesCS7D01G408900 chr4B 122823002 122824964 1962 False 2667.000000 2667 91.151000 1 1981 1 chr4B.!!$F1 1980
7 TraesCS7D01G408900 chr3B 416491339 416493223 1884 False 1262.500000 2174 92.288000 61 1984 2 chr3B.!!$F3 1923
8 TraesCS7D01G408900 chr3B 249946249 249948301 2052 False 930.666667 2113 90.680333 1 1982 3 chr3B.!!$F2 1981
9 TraesCS7D01G408900 chr4A 201184329 201186021 1692 False 2102.000000 2102 89.359000 131 1799 1 chr4A.!!$F1 1668

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
676 867 0.615331 AAGAGCGCAAAGGAGGATCA 59.385 50.0 11.47 0.0 36.25 2.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2117 2353 0.97401 CCCCTGCCTCGTGTTACCTA 60.974 60.0 0.0 0.0 0.0 3.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
542 732 3.584848 GGATATGCACTAGGGTTGAGGAT 59.415 47.826 0.00 0.00 0.00 3.24
561 751 3.967987 GGATAAGGAGAGTAAAGAGGCCA 59.032 47.826 5.01 0.00 0.00 5.36
666 857 2.359107 CAGCCAGGAAGAGCGCAA 60.359 61.111 11.47 0.00 0.00 4.85
676 867 0.615331 AAGAGCGCAAAGGAGGATCA 59.385 50.000 11.47 0.00 36.25 2.92
677 868 0.615331 AGAGCGCAAAGGAGGATCAA 59.385 50.000 11.47 0.00 36.25 2.57
1185 1407 8.850156 AGCTACTTCTTTCTTTCAATTTTGCTA 58.150 29.630 0.00 0.00 0.00 3.49
1282 1507 0.394762 TGCACCCTCATGAAGATGCC 60.395 55.000 8.23 0.00 32.02 4.40
1384 1609 3.491619 GCAGATGCTTACGAGATGGAAGA 60.492 47.826 0.00 0.00 38.21 2.87
1440 1665 2.354821 CGTGACGAGATCATGGTCTACA 59.645 50.000 8.90 7.15 40.24 2.74
1526 1751 6.546395 CCGAAAAGTCGTAGTAAGCTAGTTA 58.454 40.000 0.00 0.00 46.21 2.24
1731 1963 4.271661 TGCTATCATTGTGGCTGAAATCA 58.728 39.130 0.00 0.00 0.00 2.57
1889 2125 3.732892 GCCAACGCCAGCGCTAAA 61.733 61.111 10.99 0.00 44.19 1.85
1974 2210 2.760374 CCATAGCTAGGCTTTTCTCCG 58.240 52.381 0.00 0.00 40.44 4.63
2071 2307 1.662122 GTCGTTGTCGGTGTCAAAACT 59.338 47.619 0.00 0.00 37.69 2.66
2117 2353 3.735208 CGAACTGTGCGTCTAAGGATCAT 60.735 47.826 0.00 0.00 0.00 2.45
2171 2407 1.766496 CAGGTTCGGGCCCTCTTAATA 59.234 52.381 22.43 0.00 0.00 0.98
2210 2446 7.227156 ACTTCCTACTTGATTGACTTTGATGT 58.773 34.615 0.00 0.00 0.00 3.06
2362 2598 4.562143 GGGTTGTACAGAGTCGGTTTACAT 60.562 45.833 0.00 0.00 0.00 2.29
2449 2685 1.143889 CAGGGGGAAGCCTTCTATTCC 59.856 57.143 4.15 0.00 43.60 3.01
2458 2694 4.875561 AGCCTTCTATTCCGTATCTTCC 57.124 45.455 0.00 0.00 0.00 3.46
2507 2743 2.995574 CCGAACACCCGAGGACCT 60.996 66.667 0.00 0.00 0.00 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
542 732 4.684724 TCTTGGCCTCTTTACTCTCCTTA 58.315 43.478 3.32 0.00 0.00 2.69
666 857 2.243221 CCCAGTCCATTTGATCCTCCTT 59.757 50.000 0.00 0.00 0.00 3.36
676 867 1.620524 CCAAGGCATCCCAGTCCATTT 60.621 52.381 0.00 0.00 0.00 2.32
677 868 0.032813 CCAAGGCATCCCAGTCCATT 60.033 55.000 0.00 0.00 0.00 3.16
1282 1507 4.295051 ACAATTGAATTTTTGGGTCGTCG 58.705 39.130 13.59 0.00 0.00 5.12
1384 1609 1.613630 AACGTGGCTCTCTCCCCAT 60.614 57.895 0.00 0.00 32.95 4.00
1440 1665 2.256591 CGCTGTCAGCAGGCTTGTT 61.257 57.895 24.13 0.00 42.58 2.83
1526 1751 8.272889 ACATGATATATATCTTCCATGCAAGCT 58.727 33.333 20.74 1.87 35.96 3.74
1765 1997 6.783892 TGTTTTACCGACGCTAGTATTTTT 57.216 33.333 0.00 0.00 0.00 1.94
1889 2125 4.441356 CCAATATGGCGCCAGTGTTAAAAT 60.441 41.667 35.36 17.01 0.00 1.82
1974 2210 2.512515 CTTCGGCCTGGCACTAGC 60.513 66.667 22.05 0.93 41.10 3.42
2071 2307 1.457643 CCCTACCCGAGATCTGCCA 60.458 63.158 0.00 0.00 0.00 4.92
2117 2353 0.974010 CCCCTGCCTCGTGTTACCTA 60.974 60.000 0.00 0.00 0.00 3.08
2171 2407 6.862218 AGTAGGAAGTAGGGTATTACCTCT 57.138 41.667 12.54 10.15 42.09 3.69
2192 2428 7.554118 CCCTATACACATCAAAGTCAATCAAGT 59.446 37.037 0.00 0.00 0.00 3.16
2210 2446 4.950361 TCAACTCCTGTAACCCCTATACA 58.050 43.478 0.00 0.00 0.00 2.29
2362 2598 7.145985 CGTTCGGATATGAAGATTCCTTTCTA 58.854 38.462 0.00 0.00 31.62 2.10
2449 2685 2.108362 GTGGGCCGGGAAGATACG 59.892 66.667 2.18 0.00 0.00 3.06
2474 2710 0.980754 TCGGGCTATGTGACATGGGT 60.981 55.000 8.61 0.00 0.00 4.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.