AutoCloner

Multiple sequence alignment - TraesCS7D01G404500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS7D01G404500	chr7D	100.000	3511	0	0	1	3511	521896307	521892797	0.000000e+00	6484.0
1	TraesCS7D01G404500	chr7D	95.614	342	13	2	1	340	292365905	292365564	6.630000e-152	547.0
2	TraesCS7D01G404500	chr7D	95.029	342	13	3	1	338	593400247	593399906	5.160000e-148	534.0
3	TraesCS7D01G404500	chr7D	77.612	469	83	18	1980	2434	198501867	198502327	7.470000e-67	265.0
4	TraesCS7D01G404500	chr7B	92.308	2587	92	33	503	3058	555710321	555707811	0.000000e+00	3576.0
5	TraesCS7D01G404500	chr7B	81.674	442	26	25	3068	3501	555707754	555707360	2.030000e-82	316.0
6	TraesCS7D01G404500	chr7B	90.278	72	6	1	333	403	555710424	555710353	3.730000e-15	93.5
7	TraesCS7D01G404500	chr7A	90.805	2708	103	72	618	3280	602231183	602233789	0.000000e+00	3487.0
8	TraesCS7D01G404500	chr7A	80.321	249	25	16	3266	3503	602233854	602234089	2.170000e-37	167.0
9	TraesCS7D01G404500	chr2D	97.101	483	14	0	1527	2009	80653611	80654093	0.000000e+00	815.0
10	TraesCS7D01G404500	chr2D	95.308	341	11	5	1	337	593721965	593721626	1.430000e-148	536.0
11	TraesCS7D01G404500	chr2D	95.029	342	12	5	1	338	516845584	516845924	1.860000e-147	532.0
12	TraesCS7D01G404500	chr2D	95.000	340	12	4	1	335	295158962	295159301	2.400000e-146	529.0
13	TraesCS7D01G404500	chr6A	79.720	1144	201	20	1354	2486	71066744	71067867	0.000000e+00	798.0
14	TraesCS7D01G404500	chr6D	79.072	1142	212	19	1354	2486	56551986	56553109	0.000000e+00	760.0
15	TraesCS7D01G404500	chr6D	95.000	340	14	3	1	337	389334413	389334074	6.670000e-147	531.0
16	TraesCS7D01G404500	chr6D	94.706	340	14	3	1	337	467364725	467365063	3.100000e-145	525.0
17	TraesCS7D01G404500	chr6B	78.772	1140	219	16	1354	2486	127039793	127040916	0.000000e+00	743.0
18	TraesCS7D01G404500	chr6B	72.598	916	211	36	1595	2487	597557633	597556735	7.470000e-67	265.0
19	TraesCS7D01G404500	chr1D	93.699	492	18	2	1527	2018	344130545	344130067	0.000000e+00	725.0
20	TraesCS7D01G404500	chr4D	95.322	342	12	4	1	340	36584088	36583749	1.110000e-149	540.0
21	TraesCS7D01G404500	chr3D	94.706	340	16	2	1	338	594544500	594544839	8.630000e-146	527.0
22	TraesCS7D01G404500	chr3A	84.821	112	15	2	2128	2238	12440807	12440917	1.030000e-20	111.0
23	TraesCS7D01G404500	chr3A	79.518	166	25	9	2112	2274	12960953	12961112	3.710000e-20	110.0

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS7D01G404500	chr7D	521892797	521896307	3510	True	6484.0	6484	100.000000	1	3511	1	chr7D.!!$R2	3510
1	TraesCS7D01G404500	chr7B	555707360	555710424	3064	True	1328.5	3576	88.086667	333	3501	3	chr7B.!!$R1	3168
2	TraesCS7D01G404500	chr7A	602231183	602234089	2906	False	1827.0	3487	85.563000	618	3503	2	chr7A.!!$F1	2885
3	TraesCS7D01G404500	chr6A	71066744	71067867	1123	False	798.0	798	79.720000	1354	2486	1	chr6A.!!$F1	1132
4	TraesCS7D01G404500	chr6D	56551986	56553109	1123	False	760.0	760	79.072000	1354	2486	1	chr6D.!!$F1	1132
5	TraesCS7D01G404500	chr6B	127039793	127040916	1123	False	743.0	743	78.772000	1354	2486	1	chr6B.!!$F1	1132
6	TraesCS7D01G404500	chr6B	597556735	597557633	898	True	265.0	265	72.598000	1595	2487	1	chr6B.!!$R1	892

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
41	42	0.033642	GCTATCTACCGGTGAAGGGC	59.966	60.0	19.93	12.43	35.02	5.19	F
586	587	0.094216	CAGAGCGCGAGTGTGAAATG	59.906	55.0	12.10	0.00	0.00	2.32	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
1702	1760	0.037326	GATGTCCGTGAGCAGGAACA	60.037	55.000	0.00	0.0	39.84	3.18	R
2514	2582	2.047465	AGGTGCAAGCAGAGCTCG	60.047	61.111	8.37	4.6	38.25	5.03	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
17	18	3.116463	GCTATTTTTCCGGCGGGG	58.884	61.111	27.98	0.32	37.02	5.73
18	19	1.452470	GCTATTTTTCCGGCGGGGA	60.452	57.895	27.98	12.78	45.40	4.81
26	27	3.953775	CCGGCGGGGAATGGCTAT	61.954	66.667	20.56	0.00	38.47	2.97
27	28	2.358737	CGGCGGGGAATGGCTATC	60.359	66.667	0.00	0.00	0.00	2.08
28	29	2.883828	CGGCGGGGAATGGCTATCT	61.884	63.158	0.00	0.00	0.00	1.98
29	30	1.541310	CGGCGGGGAATGGCTATCTA	61.541	60.000	0.00	0.00	0.00	1.98
30	31	0.036294	GGCGGGGAATGGCTATCTAC	60.036	60.000	0.00	0.00	0.00	2.59
31	32	0.036294	GCGGGGAATGGCTATCTACC	60.036	60.000	0.00	0.00	0.00	3.18
32	33	0.246635	CGGGGAATGGCTATCTACCG	59.753	60.000	5.21	5.21	33.53	4.02
33	34	0.613777	GGGGAATGGCTATCTACCGG	59.386	60.000	0.00	0.00	0.00	5.28
34	35	1.349067	GGGAATGGCTATCTACCGGT	58.651	55.000	13.98	13.98	0.00	5.28
35	36	1.002087	GGGAATGGCTATCTACCGGTG	59.998	57.143	19.93	7.59	0.00	4.94
36	37	1.968493	GGAATGGCTATCTACCGGTGA	59.032	52.381	19.93	13.35	0.00	4.02
37	38	2.367567	GGAATGGCTATCTACCGGTGAA	59.632	50.000	19.93	5.07	0.00	3.18
38	39	3.555168	GGAATGGCTATCTACCGGTGAAG	60.555	52.174	19.93	7.88	0.00	3.02
39	40	1.410004	TGGCTATCTACCGGTGAAGG	58.590	55.000	19.93	10.49	37.30	3.46
40	41	0.680061	GGCTATCTACCGGTGAAGGG	59.320	60.000	19.93	5.83	35.02	3.95
41	42	0.033642	GCTATCTACCGGTGAAGGGC	59.966	60.000	19.93	12.43	35.02	5.19
42	43	0.314302	CTATCTACCGGTGAAGGGCG	59.686	60.000	19.93	0.00	35.02	6.13
43	44	1.111116	TATCTACCGGTGAAGGGCGG	61.111	60.000	19.93	0.00	35.02	6.13
44	45	4.832608	CTACCGGTGAAGGGCGGC	62.833	72.222	19.93	0.00	35.02	6.53
66	67	3.379445	CGGCGCCGGGATATACCT	61.379	66.667	40.50	0.00	38.98	3.08
67	68	2.048023	CGGCGCCGGGATATACCTA	61.048	63.158	40.50	0.00	38.98	3.08
68	69	1.814527	GGCGCCGGGATATACCTAG	59.185	63.158	12.58	0.00	38.98	3.02
69	70	0.969409	GGCGCCGGGATATACCTAGT	60.969	60.000	12.58	0.00	38.98	2.57

Showing 1 to 25 of 299 entries

Previous1 2 3 4 5…12Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
0	1	1.452470	TCCCCGCCGGAAAAATAGC	60.452	57.895	5.05	0.00	37.88	2.97
1	2	4.968370	TCCCCGCCGGAAAAATAG	57.032	55.556	5.05	0.00	37.88	1.73
9	10	3.901797	GATAGCCATTCCCCGCCGG	62.902	68.421	0.00	0.00	0.00	6.13
10	11	1.541310	TAGATAGCCATTCCCCGCCG	61.541	60.000	0.00	0.00	0.00	6.46
11	12	0.036294	GTAGATAGCCATTCCCCGCC	60.036	60.000	0.00	0.00	0.00	6.13
12	13	0.036294	GGTAGATAGCCATTCCCCGC	60.036	60.000	0.00	0.00	0.00	6.13
13	14	0.246635	CGGTAGATAGCCATTCCCCG	59.753	60.000	0.00	0.00	0.00	5.73
14	15	0.613777	CCGGTAGATAGCCATTCCCC	59.386	60.000	0.00	0.00	0.00	4.81
15	16	1.002087	CACCGGTAGATAGCCATTCCC	59.998	57.143	6.87	0.00	0.00	3.97
16	17	1.968493	TCACCGGTAGATAGCCATTCC	59.032	52.381	6.87	0.00	0.00	3.01
17	18	3.555168	CCTTCACCGGTAGATAGCCATTC	60.555	52.174	6.87	0.00	0.00	2.67
18	19	2.368875	CCTTCACCGGTAGATAGCCATT	59.631	50.000	6.87	0.00	0.00	3.16
19	20	1.971357	CCTTCACCGGTAGATAGCCAT	59.029	52.381	6.87	0.00	0.00	4.40
20	21	1.410004	CCTTCACCGGTAGATAGCCA	58.590	55.000	6.87	0.00	0.00	4.75
21	22	0.680061	CCCTTCACCGGTAGATAGCC	59.320	60.000	6.87	0.00	0.00	3.93
22	23	0.033642	GCCCTTCACCGGTAGATAGC	59.966	60.000	6.87	4.29	0.00	2.97
23	24	0.314302	CGCCCTTCACCGGTAGATAG	59.686	60.000	6.87	1.83	0.00	2.08
24	25	1.111116	CCGCCCTTCACCGGTAGATA	61.111	60.000	6.87	0.00	39.67	1.98
25	26	2.432300	CCGCCCTTCACCGGTAGAT	61.432	63.158	6.87	0.00	39.67	1.98
26	27	3.072468	CCGCCCTTCACCGGTAGA	61.072	66.667	6.87	4.45	39.67	2.59
27	28	4.832608	GCCGCCCTTCACCGGTAG	62.833	72.222	6.87	0.89	45.98	3.18
49	50	2.001361	CTAGGTATATCCCGGCGCCG	62.001	65.000	41.00	41.00	36.75	6.46
50	51	0.969409	ACTAGGTATATCCCGGCGCC	60.969	60.000	19.07	19.07	36.75	6.53
51	52	0.172803	CACTAGGTATATCCCGGCGC	59.827	60.000	0.00	0.00	36.75	6.53
52	53	0.815734	CCACTAGGTATATCCCGGCG	59.184	60.000	0.00	0.00	36.75	6.46

Showing 1 to 25 of 301 entries

Previous1 2 3 4 5…13Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.