Multiple sequence alignment - TraesCS7D01G402700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G402700 chr7D 100.000 2769 0 0 1 2769 520281552 520278784 0.000000e+00 5114.0
1 TraesCS7D01G402700 chr7D 98.882 2773 19 3 1 2769 520273952 520271188 0.000000e+00 4939.0
2 TraesCS7D01G402700 chr7D 92.191 1447 102 8 424 1862 520344989 520343546 0.000000e+00 2036.0
3 TraesCS7D01G402700 chr7D 98.148 108 2 0 297 404 520015278 520015385 3.640000e-44 189.0
4 TraesCS7D01G402700 chr7D 96.970 33 1 0 1824 1856 520272033 520272001 3.850000e-04 56.5
5 TraesCS7D01G402700 chr7D 96.970 33 1 0 1926 1958 520272135 520272103 3.850000e-04 56.5
6 TraesCS7D01G402700 chr7D 96.970 33 1 0 1824 1856 520279627 520279595 3.850000e-04 56.5
7 TraesCS7D01G402700 chr7D 96.970 33 1 0 1926 1958 520279729 520279697 3.850000e-04 56.5
8 TraesCS7D01G402700 chr7A 92.154 1848 123 14 9 1844 596647585 596649422 0.000000e+00 2590.0
9 TraesCS7D01G402700 chr7A 92.154 1848 123 14 9 1844 596655650 596657487 0.000000e+00 2590.0
10 TraesCS7D01G402700 chr7A 92.067 1853 122 17 5 1836 596339747 596341595 0.000000e+00 2584.0
11 TraesCS7D01G402700 chr7A 89.357 1400 113 24 470 1847 596327893 596329278 0.000000e+00 1727.0
12 TraesCS7D01G402700 chr7B 91.793 1852 118 11 7 1848 553321322 553323149 0.000000e+00 2547.0
13 TraesCS7D01G402700 chr7B 90.028 361 28 4 2272 2628 553323717 553324073 6.990000e-126 460.0
14 TraesCS7D01G402700 chr7B 91.772 158 12 1 1851 2007 553323183 553323340 4.640000e-53 219.0
15 TraesCS7D01G402700 chr7B 97.436 78 2 0 2028 2105 553323327 553323404 1.730000e-27 134.0
16 TraesCS7D01G402700 chr7B 91.667 96 6 2 2106 2200 553323600 553323694 6.220000e-27 132.0
17 TraesCS7D01G402700 chr3A 94.340 53 2 1 330 381 520425695 520425747 2.290000e-11 80.5
18 TraesCS7D01G402700 chr6D 82.418 91 15 1 42 132 428300669 428300758 8.220000e-11 78.7
19 TraesCS7D01G402700 chr4B 84.000 75 12 0 2695 2769 89383166 89383240 3.830000e-09 73.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G402700 chr7D 520278784 520281552 2768 True 1742.333333 5114 97.980000 1 2769 3 chr7D.!!$R3 2768
1 TraesCS7D01G402700 chr7D 520343546 520344989 1443 True 2036.000000 2036 92.191000 424 1862 1 chr7D.!!$R1 1438
2 TraesCS7D01G402700 chr7D 520271188 520273952 2764 True 1684.000000 4939 97.607333 1 2769 3 chr7D.!!$R2 2768
3 TraesCS7D01G402700 chr7A 596647585 596649422 1837 False 2590.000000 2590 92.154000 9 1844 1 chr7A.!!$F3 1835
4 TraesCS7D01G402700 chr7A 596655650 596657487 1837 False 2590.000000 2590 92.154000 9 1844 1 chr7A.!!$F4 1835
5 TraesCS7D01G402700 chr7A 596339747 596341595 1848 False 2584.000000 2584 92.067000 5 1836 1 chr7A.!!$F2 1831
6 TraesCS7D01G402700 chr7A 596327893 596329278 1385 False 1727.000000 1727 89.357000 470 1847 1 chr7A.!!$F1 1377
7 TraesCS7D01G402700 chr7B 553321322 553324073 2751 False 698.400000 2547 92.539200 7 2628 5 chr7B.!!$F1 2621

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
435 441 3.791887 GTGATATCACGTAGCGGCATATC 59.208 47.826 19.63 5.84 37.10 1.63 F
1254 1276 2.930950 GCAATGGGAATGCCTACAGTA 58.069 47.619 0.00 0.00 37.85 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1455 1477 1.590147 CTCCGTAACCGCTGGAGTT 59.41 57.895 1.50 0.00 43.48 3.01 R
2246 2512 2.300152 CAAGCTCTTGTGAGTCACCCTA 59.70 50.000 20.43 5.36 42.13 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
435 441 3.791887 GTGATATCACGTAGCGGCATATC 59.208 47.826 19.63 5.84 37.10 1.63
1254 1276 2.930950 GCAATGGGAATGCCTACAGTA 58.069 47.619 0.00 0.00 37.85 2.74
2135 2400 2.034124 CCAATCCGGCATTCCAATTCT 58.966 47.619 0.00 0.00 0.00 2.40
2152 2418 5.765182 CCAATTCTAGATAGGCGGTTTGAAT 59.235 40.000 0.00 0.00 0.00 2.57
2246 2512 2.634815 GAGGGTGACTCATGATGCAT 57.365 50.000 0.00 0.00 45.85 3.96
2372 2641 1.966354 ACGATGCTGATAGGCTGATGA 59.034 47.619 0.00 0.00 0.00 2.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
16 17 8.893563 TCCATCCATTCAACTAATAAAACCTT 57.106 30.769 0.00 0.00 0.00 3.50
435 441 1.739562 GCGACACTGCCCTCTTCAG 60.740 63.158 0.00 0.00 37.56 3.02
1254 1276 1.910722 CATGGGCTCCACTACTGCT 59.089 57.895 0.00 0.00 35.80 4.24
1455 1477 1.590147 CTCCGTAACCGCTGGAGTT 59.410 57.895 1.50 0.00 43.48 3.01
2135 2400 5.607939 TGAGAATTCAAACCGCCTATCTA 57.392 39.130 8.44 0.00 0.00 1.98
2246 2512 2.300152 CAAGCTCTTGTGAGTCACCCTA 59.700 50.000 20.43 5.36 42.13 3.53
2372 2641 3.084039 CGTAATATGATTGGCCTGCCAT 58.916 45.455 12.40 6.92 46.64 4.40
2467 2736 5.591067 AGTTAACGGAACTCAAAATTGACCA 59.409 36.000 0.00 0.00 45.81 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.