Multiple sequence alignment - TraesCS7D01G402600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G402600 chr7D 100.000 2769 0 0 1 2769 520273958 520271190 0.000000e+00 5114.0
1 TraesCS7D01G402600 chr7D 98.884 2777 19 3 1 2769 520281558 520278786 0.000000e+00 4946.0
2 TraesCS7D01G402600 chr7D 92.191 1447 102 8 424 1862 520344989 520343546 0.000000e+00 2036.0
3 TraesCS7D01G402600 chr7D 98.148 108 2 0 297 404 520015278 520015385 3.640000e-44 189.0
4 TraesCS7D01G402600 chr7D 96.970 33 1 0 1824 1856 520272033 520272001 3.850000e-04 56.5
5 TraesCS7D01G402600 chr7D 96.970 33 1 0 1926 1958 520272135 520272103 3.850000e-04 56.5
6 TraesCS7D01G402600 chr7D 96.970 33 1 0 1824 1856 520279627 520279595 3.850000e-04 56.5
7 TraesCS7D01G402600 chr7D 96.970 33 1 0 1926 1958 520279729 520279697 3.850000e-04 56.5
8 TraesCS7D01G402600 chr7A 91.734 1863 123 17 1 1836 596339737 596341595 0.000000e+00 2558.0
9 TraesCS7D01G402600 chr7A 91.784 1850 125 15 13 1844 596647582 596649422 0.000000e+00 2549.0
10 TraesCS7D01G402600 chr7A 91.784 1850 125 15 13 1844 596655647 596657487 0.000000e+00 2549.0
11 TraesCS7D01G402600 chr7A 89.293 1401 112 26 470 1847 596327893 596329278 0.000000e+00 1722.0
12 TraesCS7D01G402600 chr7B 91.626 1851 117 12 13 1848 553321322 553323149 0.000000e+00 2525.0
13 TraesCS7D01G402600 chr7B 89.197 361 31 4 2272 2628 553323717 553324073 7.040000e-121 444.0
14 TraesCS7D01G402600 chr7B 91.139 158 13 1 1851 2007 553323183 553323340 2.160000e-51 213.0
15 TraesCS7D01G402600 chr7B 92.708 96 5 2 2106 2200 553323600 553323694 1.340000e-28 137.0
16 TraesCS7D01G402600 chr7B 97.436 78 2 0 2028 2105 553323327 553323404 1.730000e-27 134.0
17 TraesCS7D01G402600 chr3A 94.340 53 2 1 330 381 520425695 520425747 2.290000e-11 80.5
18 TraesCS7D01G402600 chr4B 83.562 73 12 0 2697 2769 89383166 89383238 4.950000e-08 69.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G402600 chr7D 520271190 520273958 2768 True 1742.333333 5114 97.9800 1 2769 3 chr7D.!!$R2 2768
1 TraesCS7D01G402600 chr7D 520343546 520344989 1443 True 2036.000000 2036 92.1910 424 1862 1 chr7D.!!$R1 1438
2 TraesCS7D01G402600 chr7D 520278786 520281558 2772 True 1686.333333 4946 97.6080 1 2769 3 chr7D.!!$R3 2768
3 TraesCS7D01G402600 chr7A 596339737 596341595 1858 False 2558.000000 2558 91.7340 1 1836 1 chr7A.!!$F2 1835
4 TraesCS7D01G402600 chr7A 596647582 596649422 1840 False 2549.000000 2549 91.7840 13 1844 1 chr7A.!!$F3 1831
5 TraesCS7D01G402600 chr7A 596655647 596657487 1840 False 2549.000000 2549 91.7840 13 1844 1 chr7A.!!$F4 1831
6 TraesCS7D01G402600 chr7A 596327893 596329278 1385 False 1722.000000 1722 89.2930 470 1847 1 chr7A.!!$F1 1377
7 TraesCS7D01G402600 chr7B 553321322 553324073 2751 False 690.600000 2525 92.4212 13 2628 5 chr7B.!!$F1 2615

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1077 1110 2.61651 GGCTACACTCTCACAATGGCTT 60.617 50.0 0.0 0.0 0.0 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2246 2523 0.683973 AGCTCTTGTGAGTCACCCTG 59.316 55.0 20.43 10.31 42.13 4.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1077 1110 2.616510 GGCTACACTCTCACAATGGCTT 60.617 50.000 0.00 0.00 0.00 4.35
2135 2411 1.069049 CCAATCCGGCATTCCAATTCC 59.931 52.381 0.00 0.00 0.00 3.01
2246 2523 1.661341 GAGGGTGACTCATGATGCAC 58.339 55.000 15.87 15.87 45.85 4.57
2294 2571 1.973281 CCAGACAGTTTGCGGGCAT 60.973 57.895 0.00 0.00 0.00 4.40
2503 2783 5.664457 AGTTCCGTTAACTCTTATATGGGGT 59.336 40.000 3.71 0.00 45.64 4.95
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
160 166 2.892425 GAAGCCGGTCATCCAGCG 60.892 66.667 1.90 0.00 46.00 5.18
1077 1110 4.695455 GCTAAGTGACACAAGCTTAATGGA 59.305 41.667 20.01 0.00 32.18 3.41
1373 1406 6.072649 TCCACCATAACTATATCTTCCGTCA 58.927 40.000 0.00 0.00 0.00 4.35
1699 1738 1.741525 CCCACAAGGTGCAAACAGG 59.258 57.895 0.00 0.00 31.34 4.00
2135 2411 4.191544 TGAGATTTCAAACCGCCTATCTG 58.808 43.478 0.00 0.00 0.00 2.90
2246 2523 0.683973 AGCTCTTGTGAGTCACCCTG 59.316 55.000 20.43 10.31 42.13 4.45
2328 2605 6.540189 GTGCCATGGTATATATGTTCATCCTC 59.460 42.308 14.67 0.00 0.00 3.71
2408 2688 3.315191 AGTCACCCTGAAACAAATTCGTG 59.685 43.478 0.00 0.00 41.18 4.35
2409 2689 3.551846 AGTCACCCTGAAACAAATTCGT 58.448 40.909 0.00 0.00 41.18 3.85
2645 2926 8.463930 TGACTCCACTTGAAACTTTATTTCAT 57.536 30.769 3.11 0.00 38.12 2.57
2646 2927 7.873719 TGACTCCACTTGAAACTTTATTTCA 57.126 32.000 0.00 0.00 36.71 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.