Multiple sequence alignment - TraesCS7D01G390000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G390000 chr7D 100.000 2247 0 0 405 2651 505144056 505141810 0.000000e+00 4150.0
1 TraesCS7D01G390000 chr7D 88.701 947 78 21 784 1709 505590005 505589067 0.000000e+00 1129.0
2 TraesCS7D01G390000 chr7D 86.698 1060 79 35 792 1827 505329779 505328758 0.000000e+00 1120.0
3 TraesCS7D01G390000 chr7D 96.520 661 16 7 405 1061 505352069 505351412 0.000000e+00 1086.0
4 TraesCS7D01G390000 chr7D 100.000 192 0 0 1 192 505144460 505144269 3.250000e-94 355.0
5 TraesCS7D01G390000 chr7D 98.958 192 2 0 1 192 505352331 505352140 7.030000e-91 344.0
6 TraesCS7D01G390000 chr7D 92.308 39 0 3 406 441 503340662 503340624 5.000000e-03 52.8
7 TraesCS7D01G390000 chr7A 90.859 1258 74 15 588 1839 572876264 572875042 0.000000e+00 1648.0
8 TraesCS7D01G390000 chr7A 99.850 668 1 0 1837 2504 564075223 564074556 0.000000e+00 1229.0
9 TraesCS7D01G390000 chr7A 100.000 658 0 0 1838 2495 37009225 37008568 0.000000e+00 1216.0
10 TraesCS7D01G390000 chr7A 86.372 1130 103 32 732 1827 573069984 573068872 0.000000e+00 1186.0
11 TraesCS7D01G390000 chr7A 98.894 452 5 0 1840 2291 630126403 630125952 0.000000e+00 808.0
12 TraesCS7D01G390000 chr7A 99.363 157 1 0 2348 2504 630125940 630125784 4.320000e-73 285.0
13 TraesCS7D01G390000 chr7A 92.199 141 4 2 2511 2651 572875053 572874920 2.690000e-45 193.0
14 TraesCS7D01G390000 chr7A 85.625 160 22 1 2 160 561714941 561714782 1.630000e-37 167.0
15 TraesCS7D01G390000 chr7B 91.493 1105 75 16 729 1827 533309730 533308639 0.000000e+00 1502.0
16 TraesCS7D01G390000 chr7B 90.355 902 59 19 946 1827 533373070 533372177 0.000000e+00 1158.0
17 TraesCS7D01G390000 chr7B 88.411 906 73 16 936 1831 533552691 533551808 0.000000e+00 1062.0
18 TraesCS7D01G390000 chr7B 96.552 87 3 0 594 680 533310666 533310580 7.650000e-31 145.0
19 TraesCS7D01G390000 chr7B 80.247 162 22 6 3 160 524603174 524603019 2.160000e-21 113.0
20 TraesCS7D01G390000 chr7B 92.405 79 6 0 2573 2651 533308583 533308505 2.160000e-21 113.0
21 TraesCS7D01G390000 chr7B 79.730 148 19 9 740 878 533553245 533553100 2.170000e-16 97.1
22 TraesCS7D01G390000 chr7B 87.931 58 7 0 525 582 533310798 533310741 4.740000e-08 69.4
23 TraesCS7D01G390000 chr7B 89.796 49 3 2 755 801 533373256 533373208 7.920000e-06 62.1
24 TraesCS7D01G390000 chr2A 99.704 676 0 2 1837 2511 13840476 13841150 0.000000e+00 1236.0
25 TraesCS7D01G390000 chr2A 100.000 668 0 0 1837 2504 189814834 189815501 0.000000e+00 1234.0
26 TraesCS7D01G390000 chr2A 100.000 573 0 0 1837 2409 189814037 189814609 0.000000e+00 1059.0
27 TraesCS7D01G390000 chr2A 93.671 158 9 1 3 159 17836730 17836573 4.410000e-58 235.0
28 TraesCS7D01G390000 chr5B 99.700 667 2 0 1838 2504 508260189 508260855 0.000000e+00 1221.0
29 TraesCS7D01G390000 chr5B 92.208 77 3 3 2345 2420 337179298 337179372 3.610000e-19 106.0
30 TraesCS7D01G390000 chr3D 99.696 658 2 0 1837 2494 15458146 15458803 0.000000e+00 1205.0
31 TraesCS7D01G390000 chr3B 94.944 534 25 2 1835 2367 777813551 777814083 0.000000e+00 835.0
32 TraesCS7D01G390000 chr4A 91.824 159 12 1 1 158 117286704 117286546 1.240000e-53 220.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G390000 chr7D 505141810 505144460 2650 True 2252.50 4150 100.00000 1 2651 2 chr7D.!!$R4 2650
1 TraesCS7D01G390000 chr7D 505589067 505590005 938 True 1129.00 1129 88.70100 784 1709 1 chr7D.!!$R3 925
2 TraesCS7D01G390000 chr7D 505328758 505329779 1021 True 1120.00 1120 86.69800 792 1827 1 chr7D.!!$R2 1035
3 TraesCS7D01G390000 chr7D 505351412 505352331 919 True 715.00 1086 97.73900 1 1061 2 chr7D.!!$R5 1060
4 TraesCS7D01G390000 chr7A 564074556 564075223 667 True 1229.00 1229 99.85000 1837 2504 1 chr7A.!!$R3 667
5 TraesCS7D01G390000 chr7A 37008568 37009225 657 True 1216.00 1216 100.00000 1838 2495 1 chr7A.!!$R1 657
6 TraesCS7D01G390000 chr7A 573068872 573069984 1112 True 1186.00 1186 86.37200 732 1827 1 chr7A.!!$R4 1095
7 TraesCS7D01G390000 chr7A 572874920 572876264 1344 True 920.50 1648 91.52900 588 2651 2 chr7A.!!$R5 2063
8 TraesCS7D01G390000 chr7A 630125784 630126403 619 True 546.50 808 99.12850 1840 2504 2 chr7A.!!$R6 664
9 TraesCS7D01G390000 chr7B 533372177 533373256 1079 True 610.05 1158 90.07550 755 1827 2 chr7B.!!$R3 1072
10 TraesCS7D01G390000 chr7B 533551808 533553245 1437 True 579.55 1062 84.07050 740 1831 2 chr7B.!!$R4 1091
11 TraesCS7D01G390000 chr7B 533308505 533310798 2293 True 457.35 1502 92.09525 525 2651 4 chr7B.!!$R2 2126
12 TraesCS7D01G390000 chr2A 13840476 13841150 674 False 1236.00 1236 99.70400 1837 2511 1 chr2A.!!$F1 674
13 TraesCS7D01G390000 chr2A 189814037 189815501 1464 False 1146.50 1234 100.00000 1837 2504 2 chr2A.!!$F2 667
14 TraesCS7D01G390000 chr5B 508260189 508260855 666 False 1221.00 1221 99.70000 1838 2504 1 chr5B.!!$F2 666
15 TraesCS7D01G390000 chr3D 15458146 15458803 657 False 1205.00 1205 99.69600 1837 2494 1 chr3D.!!$F1 657
16 TraesCS7D01G390000 chr3B 777813551 777814083 532 False 835.00 835 94.94400 1835 2367 1 chr3B.!!$F1 532

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
940 2229 2.10417 CTTGTCCCTGGACTCCTACTC 58.896 57.143 16.81 0.0 44.8 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2592 4727 1.064003 TGACCACTAGCCCAACACAT 58.936 50.0 0.0 0.0 0.0 3.21 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
72 73 2.356135 CCATGACTTGGGTAGGTTTCG 58.644 52.381 0.00 0.00 42.33 3.46
474 475 8.237267 CACCAACATAGAAGGTCAAGTTTATTC 58.763 37.037 0.00 0.00 32.15 1.75
861 1783 2.584791 GGCAACAAGCTCACAATAACG 58.415 47.619 0.00 0.00 44.79 3.18
940 2229 2.104170 CTTGTCCCTGGACTCCTACTC 58.896 57.143 16.81 0.00 44.80 2.59
1242 2556 0.302288 CGCTCTACTTCGACGAGGAG 59.698 60.000 14.47 12.86 0.00 3.69
1673 2992 2.654404 GGCGACGCCGAGTGATAC 60.654 66.667 25.24 0.00 39.62 2.24
1827 3163 6.035843 GGTTGATTTGCCATTGTACATGTAG 58.964 40.000 5.62 0.00 0.00 2.74
1828 3164 6.350110 GGTTGATTTGCCATTGTACATGTAGT 60.350 38.462 5.62 0.00 0.00 2.73
1829 3165 7.148154 GGTTGATTTGCCATTGTACATGTAGTA 60.148 37.037 5.62 0.00 0.00 1.82
2504 4637 0.954452 CAAGGTCTCAACTTGTGCCC 59.046 55.000 0.00 0.00 40.24 5.36
2505 4638 0.550914 AAGGTCTCAACTTGTGCCCA 59.449 50.000 0.00 0.00 0.00 5.36
2506 4639 0.773644 AGGTCTCAACTTGTGCCCAT 59.226 50.000 0.00 0.00 0.00 4.00
2507 4640 0.883833 GGTCTCAACTTGTGCCCATG 59.116 55.000 0.00 0.00 0.00 3.66
2511 4644 2.371841 TCTCAACTTGTGCCCATGTAGT 59.628 45.455 0.00 0.00 0.00 2.73
2512 4645 3.580895 TCTCAACTTGTGCCCATGTAGTA 59.419 43.478 0.00 0.00 0.00 1.82
2528 4661 7.864379 CCCATGTAGTACTAGTATTTGGTAACG 59.136 40.741 5.75 0.00 42.51 3.18
2551 4684 1.476488 GGGAATTGAAATGTGGTCCCG 59.524 52.381 0.00 0.00 35.66 5.14
2552 4685 2.167662 GGAATTGAAATGTGGTCCCGT 58.832 47.619 0.00 0.00 0.00 5.28
2553 4686 3.349022 GGAATTGAAATGTGGTCCCGTA 58.651 45.455 0.00 0.00 0.00 4.02
2555 4688 5.127491 GGAATTGAAATGTGGTCCCGTATA 58.873 41.667 0.00 0.00 0.00 1.47
2556 4689 5.008316 GGAATTGAAATGTGGTCCCGTATAC 59.992 44.000 0.00 0.00 0.00 1.47
2558 4691 4.131649 TGAAATGTGGTCCCGTATACAG 57.868 45.455 3.32 0.00 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
72 73 0.678950 GCTAGAGACTCATCAGGGCC 59.321 60.000 5.02 0.00 0.00 5.80
413 414 6.678568 AAAATTCCATGGTATTGTTGGTGA 57.321 33.333 16.46 0.00 0.00 4.02
861 1783 2.259511 CGCTCCCTTGCTTTTGGC 59.740 61.111 0.00 0.00 42.22 4.52
958 2251 7.465647 CGGAAAGACGCTGTATATATAGACGAT 60.466 40.741 21.03 11.65 0.00 3.73
1199 2513 1.200020 CGGAATTGCACAGGAAGAACC 59.800 52.381 0.00 0.00 39.35 3.62
1606 2920 0.464373 TCCGCATCTTCTTGGATGGC 60.464 55.000 6.60 0.00 42.21 4.40
2506 4639 8.677300 CCTTCGTTACCAAATACTAGTACTACA 58.323 37.037 4.31 0.00 0.00 2.74
2507 4640 8.131731 CCCTTCGTTACCAAATACTAGTACTAC 58.868 40.741 4.31 0.00 0.00 2.73
2511 4644 7.716799 TTCCCTTCGTTACCAAATACTAGTA 57.283 36.000 4.77 4.77 0.00 1.82
2512 4645 6.610075 TTCCCTTCGTTACCAAATACTAGT 57.390 37.500 0.00 0.00 0.00 2.57
2528 4661 3.195610 GGGACCACATTTCAATTCCCTTC 59.804 47.826 0.00 0.00 39.81 3.46
2592 4727 1.064003 TGACCACTAGCCCAACACAT 58.936 50.000 0.00 0.00 0.00 3.21


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.