AutoCloner

Multiple sequence alignment - TraesCS7D01G376000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS7D01G376000	chr7D	100.000	3905	0	0	1	3905	486116102	486112198	0.000000e+00	7212.0
1	TraesCS7D01G376000	chr7D	82.394	284	38	5	637	908	36481066	36480783	1.810000e-58	237.0
2	TraesCS7D01G376000	chr7A	93.397	2832	125	18	950	3766	554498536	554495752	0.000000e+00	4137.0
3	TraesCS7D01G376000	chr7A	81.667	240	38	4	675	910	735148687	735148924	1.110000e-45	195.0
4	TraesCS7D01G376000	chr7B	93.157	2718	152	14	953	3655	513817819	513815121	0.000000e+00	3958.0
5	TraesCS7D01G376000	chr7B	89.785	372	35	3	153	524	513818781	513818413	1.270000e-129	473.0
6	TraesCS7D01G376000	chr7B	88.811	286	24	5	677	961	513818277	513817999	1.040000e-90	344.0
7	TraesCS7D01G376000	chr7B	77.660	282	50	9	633	904	623759014	623758736	4.040000e-35	159.0
8	TraesCS7D01G376000	chr3B	84.477	277	32	4	631	906	700376355	700376621	2.990000e-66	263.0
9	TraesCS7D01G376000	chr3B	87.417	151	15	3	1	150	726748879	726748732	1.870000e-38	171.0
10	TraesCS7D01G376000	chr3D	81.034	290	30	9	631	906	529786930	529787208	1.420000e-49	207.0
11	TraesCS7D01G376000	chr3D	78.189	243	32	9	673	905	309946304	309946535	6.810000e-28	135.0
12	TraesCS7D01G376000	chr3A	88.024	167	11	6	1	160	121406178	121406342	5.150000e-44	189.0
13	TraesCS7D01G376000	chr5A	86.538	156	17	3	1	152	415160210	415160365	6.710000e-38	169.0
14	TraesCS7D01G376000	chr5A	84.810	158	15	7	1	152	12021409	12021563	2.430000e-32	150.0
15	TraesCS7D01G376000	chr4D	89.051	137	10	4	1	133	366222840	366222975	8.680000e-37	165.0
16	TraesCS7D01G376000	chr2D	85.714	161	18	2	1	156	560397718	560397558	8.680000e-37	165.0
17	TraesCS7D01G376000	chr2D	78.543	247	31	10	678	908	12738879	12739119	4.070000e-30	143.0
18	TraesCS7D01G376000	chr1B	85.714	161	18	5	1	156	572882688	572882528	8.680000e-37	165.0
19	TraesCS7D01G376000	chr2A	85.093	161	18	5	1	156	700093550	700093709	4.040000e-35	159.0
20	TraesCS7D01G376000	chr6D	85.065	154	18	3	5	153	380589062	380588909	6.760000e-33	152.0
21	TraesCS7D01G376000	chr6A	78.774	212	37	7	701	909	49757558	49757352	6.810000e-28	135.0
22	TraesCS7D01G376000	chr1A	75.849	265	34	14	633	896	553957611	553957376	1.480000e-19	108.0
23	TraesCS7D01G376000	chr5D	78.125	128	13	8	733	845	498861246	498861119	2.520000e-07	67.6

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS7D01G376000	chr7D	486112198	486116102	3904	True	7212.000000	7212	100.000000	1	3905	1	chr7D.!!$R2	3904
1	TraesCS7D01G376000	chr7A	554495752	554498536	2784	True	4137.000000	4137	93.397000	950	3766	1	chr7A.!!$R1	2816
2	TraesCS7D01G376000	chr7B	513815121	513818781	3660	True	1591.666667	3958	90.584333	153	3655	3	chr7B.!!$R2	3502

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Hairpin	End Stability	Orientation
580	581	0.036306	CCAACCTTGCTCTTACCCGT	59.964	55.0	0.00	0.00	5.28	F
633	634	0.106769	ACATCTGGTTGCACCACACA	60.107	50.0	4.16	44.79	3.72	F
916	917	0.618458	TGAGAACCTTGCCCGCTTAT	59.382	50.0	0.00	0.00	1.73	F
2625	2815	0.034767	TGCTTGAGCTGGAGGGAATG	60.035	55.0	4.44	42.66	2.67	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Hairpin	End Stability	Orientation
1474	1664	0.041386	AAGAACCGCCTAGAGTCCCT	59.959	55.0	0.00	0.00	4.20	R
2024	2214	0.250513	GAGGACACCAGCCAAGGTAG	59.749	60.0	0.00	40.77	3.18	R
2822	3012	0.111061	TGCCAACTGATCAACTGCCT	59.889	50.0	0.00	0.00	4.75	R
3806	4013	0.037303	CTGCAGTGACTTGGGACCAT	59.963	55.0	5.25	0.00	3.55	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
51	52	9.611284	GATTTGATCAAATTTAAAAGGTTTGCC	57.389	29.630	29.44	11.67	40.77	4.52
52	53	9.353431	ATTTGATCAAATTTAAAAGGTTTGCCT	57.647	25.926	24.83	1.00	41.52	4.75
69	70	9.138596	AGGTTTGCCTTTTCTAAAAGTAATACA	57.861	29.630	12.80	2.67	44.18	2.29
70	71	9.188588	GGTTTGCCTTTTCTAAAAGTAATACAC	57.811	33.333	12.80	5.09	42.92	2.90
71	72	9.188588	GTTTGCCTTTTCTAAAAGTAATACACC	57.811	33.333	12.80	0.00	42.92	4.16
72	73	8.700439	TTGCCTTTTCTAAAAGTAATACACCT	57.300	30.769	12.80	0.00	42.92	4.00
73	74	8.700439	TGCCTTTTCTAAAAGTAATACACCTT	57.300	30.769	12.80	0.00	42.92	3.50
74	75	9.796180	TGCCTTTTCTAAAAGTAATACACCTTA	57.204	29.630	12.80	0.00	42.92	2.69
120	121	7.422878	TTTTAAGAAACCCAACAACAACAAC	57.577	32.000	0.00	0.00	0.00	3.32
121	122	3.224884	AGAAACCCAACAACAACAACG	57.775	42.857	0.00	0.00	0.00	4.10
122	123	2.559231	AGAAACCCAACAACAACAACGT	59.441	40.909	0.00	0.00	0.00	3.99
123	124	2.640346	AACCCAACAACAACAACGTC	57.360	45.000	0.00	0.00	0.00	4.34
124	125	0.448593	ACCCAACAACAACAACGTCG	59.551	50.000	0.00	0.00	0.00	5.12
125	126	0.863957	CCCAACAACAACAACGTCGC	60.864	55.000	0.00	0.00	0.00	5.19
126	127	0.179187	CCAACAACAACAACGTCGCA	60.179	50.000	0.00	0.00	0.00	5.10
127	128	1.179332	CAACAACAACAACGTCGCAG	58.821	50.000	0.00	0.00	0.00	5.18
128	129	0.522495	AACAACAACAACGTCGCAGC	60.522	50.000	0.00	0.00	0.00	5.25
129	130	1.061729	CAACAACAACGTCGCAGCA	59.938	52.632	0.00	0.00	0.00	4.41
130	131	0.522286	CAACAACAACGTCGCAGCAA	60.522	50.000	0.00	0.00	0.00	3.91
131	132	0.169230	AACAACAACGTCGCAGCAAA	59.831	45.000	0.00	0.00	0.00	3.68
132	133	0.248054	ACAACAACGTCGCAGCAAAG	60.248	50.000	0.00	0.00	0.00	2.77
133	134	0.248054	CAACAACGTCGCAGCAAAGT	60.248	50.000	0.00	0.00	0.00	2.66
134	135	0.248054	AACAACGTCGCAGCAAAGTG	60.248	50.000	0.00	0.00	0.00	3.16
135	136	2.005537	CAACGTCGCAGCAAAGTGC	61.006	57.895	0.00	0.00	45.46	4.40
144	145	2.421314	GCAAAGTGCACCCAACCC	59.579	61.111	14.63	0.00	44.26	4.11

Showing 1 to 25 of 280 entries

Previous1 2 3 4 5…12Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
25	26	9.611284	GGCAAACCTTTTAAATTTGATCAAATC	57.389	29.630	29.08	14.28	39.88	2.17
95	96	7.307219	CGTTGTTGTTGTTGGGTTTCTTAAAAA	60.307	33.333	0.00	0.00	0.00	1.94
96	97	6.145696	CGTTGTTGTTGTTGGGTTTCTTAAAA	59.854	34.615	0.00	0.00	0.00	1.52
97	98	5.634020	CGTTGTTGTTGTTGGGTTTCTTAAA	59.366	36.000	0.00	0.00	0.00	1.52
98	99	5.162075	CGTTGTTGTTGTTGGGTTTCTTAA	58.838	37.500	0.00	0.00	0.00	1.85
99	100	4.217983	ACGTTGTTGTTGTTGGGTTTCTTA	59.782	37.500	0.00	0.00	0.00	2.10
100	101	3.006003	ACGTTGTTGTTGTTGGGTTTCTT	59.994	39.130	0.00	0.00	0.00	2.52
101	102	2.559231	ACGTTGTTGTTGTTGGGTTTCT	59.441	40.909	0.00	0.00	0.00	2.52
102	103	2.918600	GACGTTGTTGTTGTTGGGTTTC	59.081	45.455	0.00	0.00	0.00	2.78
103	104	2.668834	CGACGTTGTTGTTGTTGGGTTT	60.669	45.455	0.00	0.00	0.00	3.27
104	105	1.135632	CGACGTTGTTGTTGTTGGGTT	60.136	47.619	0.00	0.00	0.00	4.11
105	106	0.448593	CGACGTTGTTGTTGTTGGGT	59.551	50.000	0.00	0.00	0.00	4.51
106	107	0.863957	GCGACGTTGTTGTTGTTGGG	60.864	55.000	4.37	0.00	0.00	4.12
107	108	0.179187	TGCGACGTTGTTGTTGTTGG	60.179	50.000	4.37	0.00	0.00	3.77
108	109	1.179332	CTGCGACGTTGTTGTTGTTG	58.821	50.000	4.37	0.00	0.00	3.33
109	110	0.522495	GCTGCGACGTTGTTGTTGTT	60.522	50.000	4.37	0.00	0.00	2.83
110	111	1.061887	GCTGCGACGTTGTTGTTGT	59.938	52.632	4.37	0.00	0.00	3.32
111	112	0.522286	TTGCTGCGACGTTGTTGTTG	60.522	50.000	4.37	0.00	0.00	3.33
112	113	0.169230	TTTGCTGCGACGTTGTTGTT	59.831	45.000	4.37	0.00	0.00	2.83
113	114	0.248054	CTTTGCTGCGACGTTGTTGT	60.248	50.000	4.37	0.00	0.00	3.32
114	115	0.248054	ACTTTGCTGCGACGTTGTTG	60.248	50.000	4.37	0.00	0.00	3.33
115	116	0.248054	CACTTTGCTGCGACGTTGTT	60.248	50.000	4.37	0.00	0.00	2.83
116	117	1.351707	CACTTTGCTGCGACGTTGT	59.648	52.632	4.37	0.00	0.00	3.32
117	118	2.005537	GCACTTTGCTGCGACGTTG	61.006	57.895	0.00	0.00	40.96	4.10
118	119	2.327940	GCACTTTGCTGCGACGTT	59.672	55.556	0.00	0.00	40.96	3.99

Showing 1 to 25 of 298 entries

Previous1 2 3 4 5…12Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.