Multiple sequence alignment - TraesCS7D01G375400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G375400 chr7D 100.000 2392 0 0 1 2392 485663780 485661389 0 4418
1 TraesCS7D01G375400 chr7D 97.180 2411 49 1 1 2392 625868600 625871010 0 4058
2 TraesCS7D01G375400 chr7D 97.138 2411 50 1 1 2392 32520291 32517881 0 4052
3 TraesCS7D01G375400 chr6D 97.263 2411 47 1 1 2392 62081457 62079047 0 4069
4 TraesCS7D01G375400 chr6D 94.171 2419 108 9 1 2392 156016709 156014297 0 3655
5 TraesCS7D01G375400 chr6D 94.088 2419 109 10 1 2392 54816889 54819300 0 3644
6 TraesCS7D01G375400 chr5D 97.221 2411 48 1 1 2392 182586480 182584070 0 4063
7 TraesCS7D01G375400 chr5D 96.094 2304 63 7 114 2392 524004935 524007236 0 3731
8 TraesCS7D01G375400 chr3A 96.392 2411 66 3 1 2392 543423683 543426091 0 3951
9 TraesCS7D01G375400 chr3A 94.656 2414 76 18 1 2392 468236757 468234375 0 3694
10 TraesCS7D01G375400 chr2A 95.701 2419 70 6 1 2392 743397705 743395294 0 3860
11 TraesCS7D01G375400 chr4A 95.485 2414 80 5 1 2392 402278461 402280867 0 3827
12 TraesCS7D01G375400 chr6A 94.988 2414 91 5 1 2392 343410385 343407980 0 3760


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G375400 chr7D 485661389 485663780 2391 True 4418 4418 100.000 1 2392 1 chr7D.!!$R2 2391
1 TraesCS7D01G375400 chr7D 625868600 625871010 2410 False 4058 4058 97.180 1 2392 1 chr7D.!!$F1 2391
2 TraesCS7D01G375400 chr7D 32517881 32520291 2410 True 4052 4052 97.138 1 2392 1 chr7D.!!$R1 2391
3 TraesCS7D01G375400 chr6D 62079047 62081457 2410 True 4069 4069 97.263 1 2392 1 chr6D.!!$R1 2391
4 TraesCS7D01G375400 chr6D 156014297 156016709 2412 True 3655 3655 94.171 1 2392 1 chr6D.!!$R2 2391
5 TraesCS7D01G375400 chr6D 54816889 54819300 2411 False 3644 3644 94.088 1 2392 1 chr6D.!!$F1 2391
6 TraesCS7D01G375400 chr5D 182584070 182586480 2410 True 4063 4063 97.221 1 2392 1 chr5D.!!$R1 2391
7 TraesCS7D01G375400 chr5D 524004935 524007236 2301 False 3731 3731 96.094 114 2392 1 chr5D.!!$F1 2278
8 TraesCS7D01G375400 chr3A 543423683 543426091 2408 False 3951 3951 96.392 1 2392 1 chr3A.!!$F1 2391
9 TraesCS7D01G375400 chr3A 468234375 468236757 2382 True 3694 3694 94.656 1 2392 1 chr3A.!!$R1 2391
10 TraesCS7D01G375400 chr2A 743395294 743397705 2411 True 3860 3860 95.701 1 2392 1 chr2A.!!$R1 2391
11 TraesCS7D01G375400 chr4A 402278461 402280867 2406 False 3827 3827 95.485 1 2392 1 chr4A.!!$F1 2391
12 TraesCS7D01G375400 chr6A 343407980 343410385 2405 True 3760 3760 94.988 1 2392 1 chr6A.!!$R1 2391

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
362 384 0.396695 CCCTTGCTGAATGGCCATCT 60.397 55.0 21.08 9.52 0.0 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2005 2040 1.026718 GGTTCCCATCTGTTGGCTCG 61.027 60.0 0.0 0.0 44.97 5.03 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
362 384 0.396695 CCCTTGCTGAATGGCCATCT 60.397 55.000 21.08 9.52 0.00 2.90
547 570 7.524717 AAGGTTTTAAAGCATCTAAGAAGCA 57.475 32.000 9.59 0.00 0.00 3.91
583 607 8.570488 TGGATCTGCAAAGCTAAATATTACATG 58.430 33.333 0.00 0.00 0.00 3.21
724 749 3.496130 CCTACCATTCATCGACTCATTGC 59.504 47.826 0.00 0.00 0.00 3.56
803 828 7.812309 TCGATAATGCACTGCTTATGTATAC 57.188 36.000 1.98 0.00 0.00 1.47
1058 1085 8.816894 TCAGGTTATCTCTAAGATCACAGTTTT 58.183 33.333 0.00 0.00 36.20 2.43
1213 1240 7.724305 ATCTTACTCGCAAGTTAGTTTTGAA 57.276 32.000 0.00 0.00 36.92 2.69
1491 1518 3.015934 TGCGATTATTCATGCATTGGC 57.984 42.857 0.00 0.00 41.68 4.52
2005 2040 6.624423 ACATGATGGCAAAGTTTGTAGAATC 58.376 36.000 16.70 13.64 0.00 2.52
2131 2174 0.895530 TGCCTACGAAGAGGGTTGAG 59.104 55.000 0.00 0.00 37.06 3.02
2238 2281 3.656651 TTCTTCAAATGCGCTCATACG 57.343 42.857 9.73 0.00 31.46 3.06
2282 2325 8.325421 TCGAATGTTTAAAGCAATGGTAAGTA 57.675 30.769 0.00 0.00 0.00 2.24
2324 2371 9.237187 TCTTCATGTTTACCTGCATTTTATACA 57.763 29.630 0.00 0.00 0.00 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
93 94 3.068448 ACAAAGCATTGATGTTCTGCACA 59.932 39.130 8.96 0.00 38.94 4.57
547 570 3.985019 TTGCAGATCCATTGGCAAAAT 57.015 38.095 3.01 0.00 42.66 1.82
583 607 1.632589 ACCACCCAATTTTCCAGAGC 58.367 50.000 0.00 0.00 0.00 4.09
724 749 1.931906 ACGCACTATCATGTCTGCAG 58.068 50.000 7.63 7.63 0.00 4.41
803 828 7.122055 TGTCCCCTAAAGCATACAACAAATAAG 59.878 37.037 0.00 0.00 0.00 1.73
823 850 0.914417 TCCAAGTCCCATCTGTCCCC 60.914 60.000 0.00 0.00 0.00 4.81
824 851 0.991920 TTCCAAGTCCCATCTGTCCC 59.008 55.000 0.00 0.00 0.00 4.46
1058 1085 8.623903 GCCATTTCATCTTCACACATAATAGAA 58.376 33.333 0.00 0.00 0.00 2.10
1180 1207 5.245531 ACTTGCGAGTAAGATTTTGATCCA 58.754 37.500 4.25 0.00 33.32 3.41
1381 1408 8.345724 ACTCACGTAAACTTTCTAGGAATCTA 57.654 34.615 0.00 0.00 0.00 1.98
1491 1518 5.880054 AGATGAAACAAGAATAACACGGG 57.120 39.130 0.00 0.00 0.00 5.28
1535 1563 5.575157 TGGAAGGAACAATTATAGGTGCAA 58.425 37.500 0.00 0.00 0.00 4.08
1824 1858 7.175467 TGCATGTTCATCTTGTAGTTGATCTTT 59.825 33.333 0.00 0.00 0.00 2.52
1840 1874 4.338964 TCTCTTGTGTGTTTGCATGTTCAT 59.661 37.500 0.00 0.00 0.00 2.57
2005 2040 1.026718 GGTTCCCATCTGTTGGCTCG 61.027 60.000 0.00 0.00 44.97 5.03
2041 2076 4.161565 TCTTACAAGGTCGGAAGCATATGT 59.838 41.667 4.29 0.00 0.00 2.29
2131 2174 9.691362 TGCAAGTTTGGATTACTATTTTCTTTC 57.309 29.630 0.00 0.00 0.00 2.62
2238 2281 1.139095 GAATGCCTTGCTGCAGCTC 59.861 57.895 36.61 21.40 45.93 4.09
2282 2325 5.127682 ACATGAAGAGAAAGCAAAGGTTGTT 59.872 36.000 0.00 0.00 0.00 2.83
2324 2371 7.016072 AGCTAGCTAACTATGAAGACCAATGAT 59.984 37.037 17.69 0.00 0.00 2.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.