Multiple sequence alignment - TraesCS7D01G368900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G368900 chr7D 100.000 2032 0 0 1 2032 477865365 477867396 0.000000e+00 3753
1 TraesCS7D01G368900 chr7D 92.124 1676 125 3 122 1795 477968736 477970406 0.000000e+00 2357
2 TraesCS7D01G368900 chr7D 92.254 1588 109 4 128 1704 585538056 585539640 0.000000e+00 2239
3 TraesCS7D01G368900 chr7D 100.000 365 0 0 2356 2720 477867720 477868084 0.000000e+00 675
4 TraesCS7D01G368900 chr7D 89.796 147 5 7 1895 2032 173020206 173020061 2.150000e-41 180
5 TraesCS7D01G368900 chr7B 95.923 2036 67 6 1 2032 502908311 502910334 0.000000e+00 3286
6 TraesCS7D01G368900 chr7B 92.674 1679 116 3 122 1798 503106651 503108324 0.000000e+00 2412
7 TraesCS7D01G368900 chr7B 90.222 1759 139 14 138 1875 654252901 654251155 0.000000e+00 2265
8 TraesCS7D01G368900 chr7B 93.207 368 20 5 2356 2720 502910490 502910855 1.110000e-148 536
9 TraesCS7D01G368900 chr7A 96.350 1945 52 6 1 1934 518505818 518503882 0.000000e+00 3181
10 TraesCS7D01G368900 chr7A 91.974 1682 127 5 122 1801 517895617 517893942 0.000000e+00 2351
11 TraesCS7D01G368900 chr7A 89.371 1797 138 22 128 1879 675574094 675575882 0.000000e+00 2211
12 TraesCS7D01G368900 chr7A 95.652 368 13 2 2356 2720 518503110 518502743 3.020000e-164 588
13 TraesCS7D01G368900 chr7A 89.796 147 6 6 1895 2032 175244504 175244650 2.150000e-41 180
14 TraesCS7D01G368900 chr3A 75.484 1342 286 36 378 1698 33137290 33138609 1.380000e-172 616
15 TraesCS7D01G368900 chr3A 78.022 182 36 4 2366 2545 9114295 9114474 7.960000e-21 111
16 TraesCS7D01G368900 chr5D 74.636 1372 295 41 362 1701 371862276 371863626 8.510000e-155 556
17 TraesCS7D01G368900 chr5D 90.071 141 11 3 1895 2032 520251428 520251288 2.150000e-41 180
18 TraesCS7D01G368900 chr4B 91.603 131 5 4 1892 2017 652917369 652917498 2.780000e-40 176
19 TraesCS7D01G368900 chr6A 88.356 146 9 5 1895 2032 613478122 613477977 4.660000e-38 169
20 TraesCS7D01G368900 chrUn 88.276 145 7 6 1895 2029 345756814 345756958 6.030000e-37 165
21 TraesCS7D01G368900 chrUn 88.276 145 7 6 1895 2029 353376273 353376417 6.030000e-37 165
22 TraesCS7D01G368900 chr6D 88.194 144 7 6 1898 2032 390489578 390489436 2.170000e-36 163


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G368900 chr7D 477865365 477868084 2719 False 2214.0 3753 100.000 1 2720 2 chr7D.!!$F3 2719
1 TraesCS7D01G368900 chr7D 477968736 477970406 1670 False 2357.0 2357 92.124 122 1795 1 chr7D.!!$F1 1673
2 TraesCS7D01G368900 chr7D 585538056 585539640 1584 False 2239.0 2239 92.254 128 1704 1 chr7D.!!$F2 1576
3 TraesCS7D01G368900 chr7B 503106651 503108324 1673 False 2412.0 2412 92.674 122 1798 1 chr7B.!!$F1 1676
4 TraesCS7D01G368900 chr7B 654251155 654252901 1746 True 2265.0 2265 90.222 138 1875 1 chr7B.!!$R1 1737
5 TraesCS7D01G368900 chr7B 502908311 502910855 2544 False 1911.0 3286 94.565 1 2720 2 chr7B.!!$F2 2719
6 TraesCS7D01G368900 chr7A 517893942 517895617 1675 True 2351.0 2351 91.974 122 1801 1 chr7A.!!$R1 1679
7 TraesCS7D01G368900 chr7A 675574094 675575882 1788 False 2211.0 2211 89.371 128 1879 1 chr7A.!!$F2 1751
8 TraesCS7D01G368900 chr7A 518502743 518505818 3075 True 1884.5 3181 96.001 1 2720 2 chr7A.!!$R2 2719
9 TraesCS7D01G368900 chr3A 33137290 33138609 1319 False 616.0 616 75.484 378 1698 1 chr3A.!!$F2 1320
10 TraesCS7D01G368900 chr5D 371862276 371863626 1350 False 556.0 556 74.636 362 1701 1 chr5D.!!$F1 1339

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
68 69 2.363147 AGAGGGCAGGGACGAGAC 60.363 66.667 0.0 0.0 0.00 3.36 F
1491 1536 5.241403 AGGACATGTACAAGTTCATGGAA 57.759 39.130 19.4 0.0 43.68 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1269 1311 0.541392 ATAAGATCTGCGCCCACACA 59.459 50.0 4.18 0.0 0.0 3.72 R
2370 2807 0.458025 CTCGTGGCGTTCCTACCTTC 60.458 60.0 0.00 0.0 0.0 3.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
68 69 2.363147 AGAGGGCAGGGACGAGAC 60.363 66.667 0.00 0.00 0.00 3.36
1491 1536 5.241403 AGGACATGTACAAGTTCATGGAA 57.759 39.130 19.40 0.00 43.68 3.53
1596 1641 0.665835 CAACCTACAACAGCGGCAAA 59.334 50.000 1.45 0.00 0.00 3.68
1635 1680 2.746279 TCAAGGGCAACTTCCAAAGA 57.254 45.000 0.00 0.00 37.29 2.52
1659 1704 1.937191 CCATTACCAAGGGCAAGGTT 58.063 50.000 0.07 0.00 39.31 3.50
1732 1788 4.323104 GGAAGTACTGATTGAGGCTCTTGT 60.323 45.833 16.72 9.35 0.00 3.16
1774 1838 3.313690 GTTGGCGTTTCAAATACCCAAG 58.686 45.455 0.00 0.00 33.44 3.61
1892 1972 8.424274 AGGTGAAAGACATTTGTTTTTGAATC 57.576 30.769 4.17 0.00 33.28 2.52
1893 1973 7.222611 AGGTGAAAGACATTTGTTTTTGAATCG 59.777 33.333 4.17 0.00 33.28 3.34
2395 2832 1.959226 GGAACGCCACGAGAAAGCA 60.959 57.895 0.00 0.00 0.00 3.91
2532 2970 1.076024 AGCAGCCCAGATCTTCCAAAA 59.924 47.619 0.00 0.00 0.00 2.44
2533 2971 2.105766 GCAGCCCAGATCTTCCAAAAT 58.894 47.619 0.00 0.00 0.00 1.82
2579 3017 1.151899 TTGGTGGGCAGGTAGGTCT 60.152 57.895 0.00 0.00 0.00 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1269 1311 0.541392 ATAAGATCTGCGCCCACACA 59.459 50.000 4.18 0.0 0.00 3.72
1491 1536 1.270678 GGGTTCTTGCTCACGTAAGGT 60.271 52.381 0.00 0.0 46.39 3.50
1596 1641 1.867363 AGTACTTCTCGCCCCAGATT 58.133 50.000 0.00 0.0 0.00 2.40
1635 1680 1.077716 GCCCTTGGTAATGGCGAGT 60.078 57.895 0.00 0.0 35.08 4.18
1732 1788 3.266636 CCACGCACTACAAATGTCCATA 58.733 45.455 0.00 0.0 0.00 2.74
1774 1838 1.721926 GCGCGATCCTTATTCTACTGC 59.278 52.381 12.10 0.0 0.00 4.40
1836 1911 6.509418 TTGCTAATTTTCGCCATTAGAACT 57.491 33.333 10.54 0.0 36.64 3.01
1890 1970 2.108425 TCTAGATGTGCCCTAGACCGAT 59.892 50.000 0.00 0.0 38.08 4.18
1891 1971 1.493446 TCTAGATGTGCCCTAGACCGA 59.507 52.381 0.00 0.0 38.08 4.69
1892 1972 1.982660 TCTAGATGTGCCCTAGACCG 58.017 55.000 0.00 0.0 38.08 4.79
1893 1973 3.951775 CATCTAGATGTGCCCTAGACC 57.048 52.381 22.42 0.0 43.57 3.85
2370 2807 0.458025 CTCGTGGCGTTCCTACCTTC 60.458 60.000 0.00 0.0 0.00 3.46
2371 2808 0.896940 TCTCGTGGCGTTCCTACCTT 60.897 55.000 0.00 0.0 0.00 3.50
2395 2832 3.072915 TGTTTGTGAGTGACATGGAGGAT 59.927 43.478 0.00 0.0 33.40 3.24
2579 3017 2.435805 AGCTTTAGGATGCCGATCTTCA 59.564 45.455 0.00 0.0 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.