Multiple sequence alignment - TraesCS7D01G366100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G366100 chr7D 100.000 2413 0 0 1 2413 473873202 473870790 0.000000e+00 4457.0
1 TraesCS7D01G366100 chr7D 91.247 914 64 7 1 908 61279277 61278374 0.000000e+00 1230.0
2 TraesCS7D01G366100 chr5A 96.654 2421 35 9 1 2413 365326362 365328744 0.000000e+00 3980.0
3 TraesCS7D01G366100 chr1A 97.001 2334 41 9 67 2391 424800752 424803065 0.000000e+00 3895.0
4 TraesCS7D01G366100 chr1A 95.918 49 2 0 1 49 424800704 424800752 1.990000e-11 80.5
5 TraesCS7D01G366100 chr4B 96.921 1429 39 3 989 2413 316989448 316990875 0.000000e+00 2390.0
6 TraesCS7D01G366100 chr4B 96.917 1427 41 2 989 2413 146016884 146015459 0.000000e+00 2388.0
7 TraesCS7D01G366100 chr4A 91.803 915 59 7 1 908 191356122 191357027 0.000000e+00 1260.0
8 TraesCS7D01G366100 chr7B 84.533 1306 142 33 1145 2413 146357428 146356146 0.000000e+00 1238.0
9 TraesCS7D01G366100 chr3A 83.704 1393 143 39 1041 2412 302494803 302493474 0.000000e+00 1238.0
10 TraesCS7D01G366100 chr3B 89.945 915 75 8 1 908 139391379 139392283 0.000000e+00 1164.0
11 TraesCS7D01G366100 chr3B 86.236 959 97 20 1041 1978 158633531 158634475 0.000000e+00 1007.0
12 TraesCS7D01G366100 chr3B 89.636 357 31 4 557 908 279964300 279964655 1.320000e-122 449.0
13 TraesCS7D01G366100 chr3B 88.796 357 29 5 557 908 726148313 726148663 6.160000e-116 427.0
14 TraesCS7D01G366100 chr6A 85.268 1120 118 20 1145 2236 230684191 230683091 0.000000e+00 1110.0
15 TraesCS7D01G366100 chr7A 88.720 789 61 9 1650 2413 678119717 678120502 0.000000e+00 939.0
16 TraesCS7D01G366100 chr7A 89.776 313 24 4 902 1210 678119294 678119602 6.250000e-106 394.0
17 TraesCS7D01G366100 chr6D 86.433 656 64 12 1050 1695 172389054 172389694 0.000000e+00 695.0
18 TraesCS7D01G366100 chr6D 86.301 657 66 13 1051 1696 181409404 181408761 0.000000e+00 693.0
19 TraesCS7D01G366100 chr5B 86.027 594 64 9 1196 1785 247450243 247449665 9.480000e-174 619.0
20 TraesCS7D01G366100 chr5B 84.465 663 62 25 1782 2413 247445903 247445251 1.230000e-172 616.0
21 TraesCS7D01G366100 chr5B 85.235 149 11 5 1051 1191 247343118 247342973 2.500000e-30 143.0
22 TraesCS7D01G366100 chr6B 92.148 433 32 1 478 908 417852378 417851946 5.700000e-171 610.0
23 TraesCS7D01G366100 chr6B 89.904 416 33 3 1 416 417852781 417852375 5.910000e-146 527.0
24 TraesCS7D01G366100 chr6B 89.080 348 31 5 566 908 436205998 436205653 2.220000e-115 425.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G366100 chr7D 473870790 473873202 2412 True 4457.00 4457 100.0000 1 2413 1 chr7D.!!$R2 2412
1 TraesCS7D01G366100 chr7D 61278374 61279277 903 True 1230.00 1230 91.2470 1 908 1 chr7D.!!$R1 907
2 TraesCS7D01G366100 chr5A 365326362 365328744 2382 False 3980.00 3980 96.6540 1 2413 1 chr5A.!!$F1 2412
3 TraesCS7D01G366100 chr1A 424800704 424803065 2361 False 1987.75 3895 96.4595 1 2391 2 chr1A.!!$F1 2390
4 TraesCS7D01G366100 chr4B 316989448 316990875 1427 False 2390.00 2390 96.9210 989 2413 1 chr4B.!!$F1 1424
5 TraesCS7D01G366100 chr4B 146015459 146016884 1425 True 2388.00 2388 96.9170 989 2413 1 chr4B.!!$R1 1424
6 TraesCS7D01G366100 chr4A 191356122 191357027 905 False 1260.00 1260 91.8030 1 908 1 chr4A.!!$F1 907
7 TraesCS7D01G366100 chr7B 146356146 146357428 1282 True 1238.00 1238 84.5330 1145 2413 1 chr7B.!!$R1 1268
8 TraesCS7D01G366100 chr3A 302493474 302494803 1329 True 1238.00 1238 83.7040 1041 2412 1 chr3A.!!$R1 1371
9 TraesCS7D01G366100 chr3B 139391379 139392283 904 False 1164.00 1164 89.9450 1 908 1 chr3B.!!$F1 907
10 TraesCS7D01G366100 chr3B 158633531 158634475 944 False 1007.00 1007 86.2360 1041 1978 1 chr3B.!!$F2 937
11 TraesCS7D01G366100 chr6A 230683091 230684191 1100 True 1110.00 1110 85.2680 1145 2236 1 chr6A.!!$R1 1091
12 TraesCS7D01G366100 chr7A 678119294 678120502 1208 False 666.50 939 89.2480 902 2413 2 chr7A.!!$F1 1511
13 TraesCS7D01G366100 chr6D 172389054 172389694 640 False 695.00 695 86.4330 1050 1695 1 chr6D.!!$F1 645
14 TraesCS7D01G366100 chr6D 181408761 181409404 643 True 693.00 693 86.3010 1051 1696 1 chr6D.!!$R1 645
15 TraesCS7D01G366100 chr5B 247445251 247450243 4992 True 617.50 619 85.2460 1196 2413 2 chr5B.!!$R2 1217
16 TraesCS7D01G366100 chr6B 417851946 417852781 835 True 568.50 610 91.0260 1 908 2 chr6B.!!$R2 907

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
544 550 2.533916 CTAGGCCTCATGATGCTCCTA 58.466 52.381 20.37 13.57 0.0 2.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2146 6002 2.744202 GTGTTGGAGCAGATCAAACGAT 59.256 45.455 1.44 0.0 43.86 3.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 2.832129 TGCTCTGTTCTTATTCTCCGGT 59.168 45.455 0.00 0.00 0.00 5.28
55 56 2.941720 GAGATTTTCTCAGCTCCGCATT 59.058 45.455 0.00 0.00 42.90 3.56
142 143 9.282569 GATAAAATGAGGAGATGCAAGATAGTT 57.717 33.333 0.00 0.00 0.00 2.24
352 354 9.809096 GTGACAAAAGTATTAGATGAGATCTGA 57.191 33.333 0.00 0.00 40.51 3.27
544 550 2.533916 CTAGGCCTCATGATGCTCCTA 58.466 52.381 20.37 13.57 0.00 2.94
559 565 4.708177 TGCTCCTATCCTGCATAAGTTTC 58.292 43.478 0.00 0.00 0.00 2.78
773 782 8.075593 ACATGCTAACTTGCTTGTTTAATTTG 57.924 30.769 0.00 0.00 45.04 2.32
881 891 2.924290 GCGTGCTGGTCTTTTACTCTAG 59.076 50.000 0.00 0.00 0.00 2.43
981 992 5.512753 TCAATGACAGAGAGAGCTACATC 57.487 43.478 0.00 0.00 0.00 3.06
1093 1104 0.038166 GGGAAGGACTTCATGGTGCA 59.962 55.000 13.51 0.00 41.20 4.57
1928 5773 7.639113 AATTCTTCAAACTCTTGTGGTACAA 57.361 32.000 0.00 0.00 44.16 2.41
2146 6002 2.307496 ATCACATTTGAGTGGCCCAA 57.693 45.000 0.00 0.00 39.93 4.12
2238 6109 9.515226 TGCAAACCTACTAGACAGAATAAAATT 57.485 29.630 0.00 0.00 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
142 143 3.799286 TTGGCCCATGCGGTTGTGA 62.799 57.895 0.00 0.0 38.85 3.58
352 354 3.891366 ACCAAGAGTTAGCTGCATTGTTT 59.109 39.130 1.02 0.0 0.00 2.83
468 474 4.836825 ACTCATCTGGACAGTACCAAATG 58.163 43.478 0.00 0.0 39.09 2.32
544 550 5.663106 TGAGGAGTAGAAACTTATGCAGGAT 59.337 40.000 0.00 0.0 35.56 3.24
559 565 5.189934 ACCCAACCTAAAATCTGAGGAGTAG 59.810 44.000 0.00 0.0 36.61 2.57
704 713 8.612619 CACCACAACAACCTTATCAACTATATC 58.387 37.037 0.00 0.0 0.00 1.63
773 782 2.972348 TCTCCTATATCCCACACACCC 58.028 52.381 0.00 0.0 0.00 4.61
981 992 1.257743 TCTCCCTCAGTGAAACCTCG 58.742 55.000 0.00 0.0 37.80 4.63
1093 1104 1.514678 TTCGAAGGCAAAGCACGCAT 61.515 50.000 0.00 0.0 0.00 4.73
1722 1801 8.227791 TCTATTTGTTCGTGTTTAAGAATCAGC 58.772 33.333 0.00 0.0 0.00 4.26
1928 5773 3.902881 TGTCCCAGCAAAACAACAAAT 57.097 38.095 0.00 0.0 0.00 2.32
2146 6002 2.744202 GTGTTGGAGCAGATCAAACGAT 59.256 45.455 1.44 0.0 43.86 3.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.