Multiple sequence alignment - TraesCS7D01G357600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G357600 chr7D 100.000 2246 0 0 1 2246 460799808 460802053 0.000000e+00 4148
1 TraesCS7D01G357600 chr7D 87.376 1513 108 38 749 2198 131690134 131691626 0.000000e+00 1659
2 TraesCS7D01G357600 chr7D 89.119 1158 80 24 990 2115 528562195 528563338 0.000000e+00 1399
3 TraesCS7D01G357600 chr7D 96.346 821 30 0 1 821 528561107 528561927 0.000000e+00 1351
4 TraesCS7D01G357600 chr1A 88.326 1559 104 31 750 2246 311771901 311770359 0.000000e+00 1799
5 TraesCS7D01G357600 chr1A 84.615 260 36 3 1990 2246 311770349 311770607 2.860000e-64 255
6 TraesCS7D01G357600 chr1D 87.655 1531 131 25 750 2234 14674126 14672608 0.000000e+00 1727
7 TraesCS7D01G357600 chr1D 95.737 821 34 1 1 821 446419228 446420047 0.000000e+00 1321
8 TraesCS7D01G357600 chr2D 95.459 1079 34 9 992 2057 152002070 152003146 0.000000e+00 1707
9 TraesCS7D01G357600 chr2D 88.322 1430 90 35 750 2118 619854372 619855785 0.000000e+00 1644
10 TraesCS7D01G357600 chr2D 90.973 1141 80 12 990 2111 78320026 78318890 0.000000e+00 1515
11 TraesCS7D01G357600 chr2D 96.468 821 29 0 1 821 619853551 619854371 0.000000e+00 1356
12 TraesCS7D01G357600 chrUn 87.889 1445 90 39 750 2129 10399914 10401338 0.000000e+00 1620
13 TraesCS7D01G357600 chr6D 93.401 1091 29 9 751 1799 377212947 377214036 0.000000e+00 1576
14 TraesCS7D01G357600 chr6D 96.468 821 29 0 1 821 62141160 62141980 0.000000e+00 1356
15 TraesCS7D01G357600 chr6D 90.691 1042 62 18 990 2010 62142249 62143276 0.000000e+00 1354
16 TraesCS7D01G357600 chr6D 96.238 824 31 0 1 824 377212125 377212948 0.000000e+00 1351
17 TraesCS7D01G357600 chr4D 89.189 1295 88 29 990 2246 470195629 470194349 0.000000e+00 1568
18 TraesCS7D01G357600 chr4D 96.723 824 27 0 1 824 470196718 470195895 0.000000e+00 1373
19 TraesCS7D01G357600 chr4D 97.131 244 7 0 750 993 122178539 122178782 1.610000e-111 412
20 TraesCS7D01G357600 chr5D 96.711 821 27 0 1 821 348341163 348341983 0.000000e+00 1367
21 TraesCS7D01G357600 chr5D 96.565 786 15 6 990 1763 348342252 348343037 0.000000e+00 1291
22 TraesCS7D01G357600 chr5D 96.311 244 9 0 750 993 348341984 348342227 3.470000e-108 401
23 TraesCS7D01G357600 chr3B 91.566 996 76 3 1 993 103208783 103209773 0.000000e+00 1367
24 TraesCS7D01G357600 chr3B 96.296 243 9 0 751 993 18713716 18713958 1.250000e-107 399
25 TraesCS7D01G357600 chr3D 96.590 821 28 0 1 821 446922344 446923164 0.000000e+00 1362
26 TraesCS7D01G357600 chr3D 96.721 244 8 0 750 993 446923165 446923408 7.470000e-110 407
27 TraesCS7D01G357600 chr6A 86.246 1047 116 13 1208 2234 466153196 466154234 0.000000e+00 1110
28 TraesCS7D01G357600 chr6A 88.634 915 83 10 1208 2106 466347387 466348296 0.000000e+00 1094
29 TraesCS7D01G357600 chr6A 86.579 991 102 16 1208 2178 466149456 466150435 0.000000e+00 1064
30 TraesCS7D01G357600 chr6A 85.359 1045 128 17 1208 2234 466145688 466146725 0.000000e+00 1059
31 TraesCS7D01G357600 chr6A 85.644 1010 118 15 1208 2198 466403946 466404947 0.000000e+00 1037
32 TraesCS7D01G357600 chr6A 84.623 1047 136 12 1208 2234 466407715 466408756 0.000000e+00 1018
33 TraesCS7D01G357600 chr6A 96.296 243 9 0 751 993 23005425 23005667 1.250000e-107 399
34 TraesCS7D01G357600 chr6B 95.902 244 9 1 750 993 679252372 679252614 5.810000e-106 394
35 TraesCS7D01G357600 chr5B 95.902 244 9 1 750 993 709185319 709185077 5.810000e-106 394
36 TraesCS7D01G357600 chr2B 95.902 244 9 1 750 993 68146071 68146313 5.810000e-106 394
37 TraesCS7D01G357600 chr2A 83.142 261 36 6 1990 2246 770002884 770003140 4.820000e-57 231


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G357600 chr7D 460799808 460802053 2245 False 4148.000000 4148 100.000000 1 2246 1 chr7D.!!$F2 2245
1 TraesCS7D01G357600 chr7D 131690134 131691626 1492 False 1659.000000 1659 87.376000 749 2198 1 chr7D.!!$F1 1449
2 TraesCS7D01G357600 chr7D 528561107 528563338 2231 False 1375.000000 1399 92.732500 1 2115 2 chr7D.!!$F3 2114
3 TraesCS7D01G357600 chr1A 311770359 311771901 1542 True 1799.000000 1799 88.326000 750 2246 1 chr1A.!!$R1 1496
4 TraesCS7D01G357600 chr1D 14672608 14674126 1518 True 1727.000000 1727 87.655000 750 2234 1 chr1D.!!$R1 1484
5 TraesCS7D01G357600 chr1D 446419228 446420047 819 False 1321.000000 1321 95.737000 1 821 1 chr1D.!!$F1 820
6 TraesCS7D01G357600 chr2D 152002070 152003146 1076 False 1707.000000 1707 95.459000 992 2057 1 chr2D.!!$F1 1065
7 TraesCS7D01G357600 chr2D 78318890 78320026 1136 True 1515.000000 1515 90.973000 990 2111 1 chr2D.!!$R1 1121
8 TraesCS7D01G357600 chr2D 619853551 619855785 2234 False 1500.000000 1644 92.395000 1 2118 2 chr2D.!!$F2 2117
9 TraesCS7D01G357600 chrUn 10399914 10401338 1424 False 1620.000000 1620 87.889000 750 2129 1 chrUn.!!$F1 1379
10 TraesCS7D01G357600 chr6D 377212125 377214036 1911 False 1463.500000 1576 94.819500 1 1799 2 chr6D.!!$F2 1798
11 TraesCS7D01G357600 chr6D 62141160 62143276 2116 False 1355.000000 1356 93.579500 1 2010 2 chr6D.!!$F1 2009
12 TraesCS7D01G357600 chr4D 470194349 470196718 2369 True 1470.500000 1568 92.956000 1 2246 2 chr4D.!!$R1 2245
13 TraesCS7D01G357600 chr5D 348341163 348343037 1874 False 1019.666667 1367 96.529000 1 1763 3 chr5D.!!$F1 1762
14 TraesCS7D01G357600 chr3B 103208783 103209773 990 False 1367.000000 1367 91.566000 1 993 1 chr3B.!!$F2 992
15 TraesCS7D01G357600 chr3D 446922344 446923408 1064 False 884.500000 1362 96.655500 1 993 2 chr3D.!!$F1 992
16 TraesCS7D01G357600 chr6A 466347387 466348296 909 False 1094.000000 1094 88.634000 1208 2106 1 chr6A.!!$F2 898
17 TraesCS7D01G357600 chr6A 466145688 466154234 8546 False 1077.666667 1110 86.061333 1208 2234 3 chr6A.!!$F3 1026
18 TraesCS7D01G357600 chr6A 466403946 466408756 4810 False 1027.500000 1037 85.133500 1208 2234 2 chr6A.!!$F4 1026

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
658 659 0.327924 TCATTTCATGGAGCCACCGT 59.672 50.0 0.0 0.0 42.61 4.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2157 9972 0.10339 TCTGTGACGAGAAACGCCAA 59.897 50.0 0.0 0.0 46.94 4.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
116 117 5.713861 ACTTCCTAAAGCATTCTGAAAGCAT 59.286 36.000 18.43 5.01 35.81 3.79
276 277 1.633945 GGGACAACAAGGGATGGTAGT 59.366 52.381 0.00 0.00 0.00 2.73
498 499 2.108075 TCCTTTCCTTGATGCCTCACAA 59.892 45.455 0.00 0.00 0.00 3.33
526 527 2.945668 GAGTATGTTGGGCCAGACATTC 59.054 50.000 27.47 23.71 37.62 2.67
566 567 1.777272 GGTGCCTATGAGGGGAAGAAT 59.223 52.381 0.00 0.00 35.37 2.40
658 659 0.327924 TCATTTCATGGAGCCACCGT 59.672 50.000 0.00 0.00 42.61 4.83
666 667 0.759959 TGGAGCCACCGTAGAACAAA 59.240 50.000 0.00 0.00 42.61 2.83
671 672 4.456566 GGAGCCACCGTAGAACAAAAATTA 59.543 41.667 0.00 0.00 0.00 1.40
733 737 4.441356 GCAAGAAACCAAGAACCAACATGA 60.441 41.667 0.00 0.00 0.00 3.07
748 824 4.456911 CCAACATGAGCACTAGTCAAACAT 59.543 41.667 0.00 0.00 0.00 2.71
1140 1320 2.287829 GGTGAAGGAGTCCACCGAT 58.712 57.895 12.86 0.00 42.73 4.18
1590 9286 1.226746 CACGTGACAAGAAGGGGAAC 58.773 55.000 10.90 0.00 0.00 3.62
1716 9445 3.127548 AGCCATGTGTCGTGAATGAATTC 59.872 43.478 0.00 0.00 37.31 2.17
1921 9674 1.373812 GTTGTTGGACCCTACCGCT 59.626 57.895 0.00 0.00 0.00 5.52
1957 9711 0.673985 GGTGGGGCAAAGTTTCTGTC 59.326 55.000 0.00 0.00 0.00 3.51
2079 9840 3.635373 GGGTGTATATCTTCTGTGACGGA 59.365 47.826 0.00 0.00 0.00 4.69
2206 10024 1.445582 CCTACCGCCACGTTGTCTC 60.446 63.158 0.00 0.00 0.00 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
191 192 4.462508 TTGATCACTTGTTGTTTGGCAA 57.537 36.364 0.00 0.00 34.16 4.52
276 277 4.020928 TCGTAAGCAACTCCACCATAAGAA 60.021 41.667 0.00 0.00 37.18 2.52
310 311 0.248866 CACTGGCACCAACGGTTTTC 60.249 55.000 0.00 0.00 31.02 2.29
498 499 0.106519 GCCCAACATACTCAGGCCAT 60.107 55.000 5.01 0.00 37.66 4.40
526 527 2.202987 GAGTGCGGGATCTGGCAG 60.203 66.667 8.58 8.58 40.32 4.85
566 567 7.091443 GTCACTCCGAAATCTCTTCTTTCTTA 58.909 38.462 0.00 0.00 31.79 2.10
658 659 9.638239 GTTGCATTCTCCATAATTTTTGTTCTA 57.362 29.630 0.00 0.00 0.00 2.10
666 667 5.182950 TGTGTCGTTGCATTCTCCATAATTT 59.817 36.000 0.00 0.00 0.00 1.82
671 672 2.079158 CTGTGTCGTTGCATTCTCCAT 58.921 47.619 0.00 0.00 0.00 3.41
733 737 3.403038 GTCCACATGTTTGACTAGTGCT 58.597 45.455 15.03 0.00 0.00 4.40
748 824 1.681327 GGCTAGTCCTCCGTCCACA 60.681 63.158 0.00 0.00 0.00 4.17
824 972 2.832643 TGTCCTAGAACCACCGGATA 57.167 50.000 9.46 0.00 0.00 2.59
1140 1320 1.890489 TCGGTCCATGACTTCTTTCGA 59.110 47.619 0.00 0.00 32.47 3.71
1590 9286 1.330655 ACTGAGTCATACGGGGCCAG 61.331 60.000 4.39 3.10 0.00 4.85
1716 9445 5.163972 CCACACCAAATTCAATACAAATGCG 60.164 40.000 0.00 0.00 0.00 4.73
1957 9711 2.393271 AGGGATTGCTTCTCTTCGTG 57.607 50.000 0.00 0.00 27.06 4.35
2045 9801 2.826136 ATACACCCCCTACCGCCACA 62.826 60.000 0.00 0.00 0.00 4.17
2149 9964 2.125952 GAAACGCCAATGCCCTGC 60.126 61.111 0.00 0.00 0.00 4.85
2156 9971 1.148310 CTGTGACGAGAAACGCCAAT 58.852 50.000 0.00 0.00 46.94 3.16
2157 9972 0.103390 TCTGTGACGAGAAACGCCAA 59.897 50.000 0.00 0.00 46.94 4.52
2206 10024 1.829222 AGGATGTTGTACCCTACCACG 59.171 52.381 0.00 0.00 0.00 4.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.