Multiple sequence alignment - TraesCS7D01G347100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G347100 chr7D 100.000 2414 0 0 1 2414 446554284 446551871 0.000000e+00 4458
1 TraesCS7D01G347100 chr7D 88.072 721 68 10 5 713 469637422 469636708 0.000000e+00 839
2 TraesCS7D01G347100 chr3D 96.388 1744 28 6 706 2414 16447277 16449020 0.000000e+00 2839
3 TraesCS7D01G347100 chr3D 88.302 1231 74 26 1221 2414 32171969 32173166 0.000000e+00 1411
4 TraesCS7D01G347100 chr3D 97.896 713 15 0 1 713 16431805 16432517 0.000000e+00 1234
5 TraesCS7D01G347100 chr3B 93.234 1744 59 14 706 2414 555553076 555551357 0.000000e+00 2512
6 TraesCS7D01G347100 chr3B 89.396 1226 75 19 1224 2414 685078796 685077591 0.000000e+00 1493
7 TraesCS7D01G347100 chr3B 93.889 720 32 6 5 713 555554972 555554254 0.000000e+00 1075
8 TraesCS7D01G347100 chr3B 88.315 445 42 4 949 1386 637070514 637070073 2.130000e-145 525
9 TraesCS7D01G347100 chr3B 92.058 277 22 0 438 714 254462838 254463114 8.090000e-105 390
10 TraesCS7D01G347100 chr4B 93.184 1746 58 16 706 2414 16784723 16786444 0.000000e+00 2508
11 TraesCS7D01G347100 chr4B 91.973 735 32 15 5 713 16782565 16783298 0.000000e+00 1005
12 TraesCS7D01G347100 chr5A 92.901 1634 54 21 706 2289 606396621 606395000 0.000000e+00 2318
13 TraesCS7D01G347100 chr5A 94.492 708 32 3 8 710 606398225 606397520 0.000000e+00 1085
14 TraesCS7D01G347100 chr2A 96.283 1399 27 8 1039 2414 46334480 46335876 0.000000e+00 2272
15 TraesCS7D01G347100 chr2A 94.461 686 18 5 28 713 46332336 46333001 0.000000e+00 1038
16 TraesCS7D01G347100 chr2A 90.063 634 47 5 1498 2126 363365172 363365794 0.000000e+00 808
17 TraesCS7D01G347100 chr2A 97.973 296 6 0 706 1001 46334185 46334480 4.600000e-142 514
18 TraesCS7D01G347100 chr2A 89.020 255 25 3 2156 2409 6455453 6455705 1.800000e-81 313
19 TraesCS7D01G347100 chr2A 86.166 253 29 5 700 947 648745627 648745376 3.960000e-68 268
20 TraesCS7D01G347100 chr4A 94.575 1272 42 8 706 1974 729647192 729645945 0.000000e+00 1941
21 TraesCS7D01G347100 chr4A 94.167 720 30 6 5 713 729649091 729648373 0.000000e+00 1086
22 TraesCS7D01G347100 chr4A 88.562 612 21 11 1834 2414 729645949 729645356 0.000000e+00 697
23 TraesCS7D01G347100 chr6B 95.215 836 31 5 1142 1974 247037488 247036659 0.000000e+00 1314
24 TraesCS7D01G347100 chr6B 92.610 636 31 4 1498 2129 247042266 247041643 0.000000e+00 900
25 TraesCS7D01G347100 chr6B 94.312 545 19 4 5 538 247038877 247038334 0.000000e+00 824
26 TraesCS7D01G347100 chr6B 88.543 611 23 18 1834 2414 247036663 247036070 0.000000e+00 697
27 TraesCS7D01G347100 chr7A 94.944 712 29 3 7 713 321638563 321637854 0.000000e+00 1109
28 TraesCS7D01G347100 chr7A 86.000 250 29 5 700 944 704664475 704664723 1.840000e-66 263
29 TraesCS7D01G347100 chr3A 86.769 718 77 11 8 713 640036817 640036106 0.000000e+00 784
30 TraesCS7D01G347100 chr3A 87.633 469 47 5 947 1407 621224602 621224137 3.530000e-148 534
31 TraesCS7D01G347100 chr1A 86.166 253 29 5 700 947 315270527 315270276 3.960000e-68 268


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G347100 chr7D 446551871 446554284 2413 True 4458.000000 4458 100.000000 1 2414 1 chr7D.!!$R1 2413
1 TraesCS7D01G347100 chr7D 469636708 469637422 714 True 839.000000 839 88.072000 5 713 1 chr7D.!!$R2 708
2 TraesCS7D01G347100 chr3D 16447277 16449020 1743 False 2839.000000 2839 96.388000 706 2414 1 chr3D.!!$F2 1708
3 TraesCS7D01G347100 chr3D 32171969 32173166 1197 False 1411.000000 1411 88.302000 1221 2414 1 chr3D.!!$F3 1193
4 TraesCS7D01G347100 chr3D 16431805 16432517 712 False 1234.000000 1234 97.896000 1 713 1 chr3D.!!$F1 712
5 TraesCS7D01G347100 chr3B 555551357 555554972 3615 True 1793.500000 2512 93.561500 5 2414 2 chr3B.!!$R3 2409
6 TraesCS7D01G347100 chr3B 685077591 685078796 1205 True 1493.000000 1493 89.396000 1224 2414 1 chr3B.!!$R2 1190
7 TraesCS7D01G347100 chr4B 16782565 16786444 3879 False 1756.500000 2508 92.578500 5 2414 2 chr4B.!!$F1 2409
8 TraesCS7D01G347100 chr5A 606395000 606398225 3225 True 1701.500000 2318 93.696500 8 2289 2 chr5A.!!$R1 2281
9 TraesCS7D01G347100 chr2A 46332336 46335876 3540 False 1274.666667 2272 96.239000 28 2414 3 chr2A.!!$F3 2386
10 TraesCS7D01G347100 chr2A 363365172 363365794 622 False 808.000000 808 90.063000 1498 2126 1 chr2A.!!$F2 628
11 TraesCS7D01G347100 chr4A 729645356 729649091 3735 True 1241.333333 1941 92.434667 5 2414 3 chr4A.!!$R1 2409
12 TraesCS7D01G347100 chr6B 247036070 247042266 6196 True 933.750000 1314 92.670000 5 2414 4 chr6B.!!$R1 2409
13 TraesCS7D01G347100 chr7A 321637854 321638563 709 True 1109.000000 1109 94.944000 7 713 1 chr7A.!!$R1 706
14 TraesCS7D01G347100 chr3A 640036106 640036817 711 True 784.000000 784 86.769000 8 713 1 chr3A.!!$R2 705

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
19 3405 1.697754 ATCCTGGGGAGGCCGATTT 60.698 57.895 0.0 0.0 34.05 2.17 F
535 3970 6.866480 ACATATTCCATGTGCAAAGTAAAGG 58.134 36.000 0.0 0.0 0.00 3.11 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1027 5909 3.527665 AGCACCCACCCTTCAGTATATTT 59.472 43.478 0.0 0.0 0.0 1.40 R
1878 6927 4.660303 TGCCTTGGAGTACATTGGATCTAT 59.340 41.667 0.0 0.0 0.0 1.98 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 3405 1.697754 ATCCTGGGGAGGCCGATTT 60.698 57.895 0.00 0.00 34.05 2.17
535 3970 6.866480 ACATATTCCATGTGCAAAGTAAAGG 58.134 36.000 0.00 0.00 0.00 3.11
1027 5909 5.010719 CCTAAGATAAAGATAGGCCGTGTCA 59.989 44.000 0.00 0.00 30.56 3.58
1619 6511 4.464244 TGTCACTATCAGCTAGCTCAAGTT 59.536 41.667 16.15 1.72 0.00 2.66
1652 6546 8.503486 CTGTACGATAATACAGGTTCACATAC 57.497 38.462 5.23 0.00 45.62 2.39
2253 7486 4.871933 ATCGAACAATCTTTTGGCCTTT 57.128 36.364 3.32 0.00 37.15 3.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
535 3970 3.248266 GCAACCTGCAACATCTGAATTC 58.752 45.455 0.00 0.0 44.26 2.17
923 5804 5.894298 ATAGAACATATGCCTTGTCTGGA 57.106 39.130 1.58 0.0 0.00 3.86
1027 5909 3.527665 AGCACCCACCCTTCAGTATATTT 59.472 43.478 0.00 0.0 0.00 1.40
1619 6511 8.229253 ACCTGTATTATCGTACAGTCATACAA 57.771 34.615 11.72 0.0 46.44 2.41
1652 6546 7.946207 AGGTGATAGTGACAGATTACTACATG 58.054 38.462 0.00 0.0 32.68 3.21
1878 6927 4.660303 TGCCTTGGAGTACATTGGATCTAT 59.340 41.667 0.00 0.0 0.00 1.98
2253 7486 5.365403 ACAAACAGTTGTTCGAAACTTCA 57.635 34.783 0.00 0.0 46.01 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.