Multiple sequence alignment - TraesCS7D01G335300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G335300 chr7D 100.000 2483 0 0 1 2483 426837166 426834684 0 4586
1 TraesCS7D01G335300 chr7D 97.452 2512 29 3 1 2483 634767912 634770417 0 4252
2 TraesCS7D01G335300 chr7D 96.267 2518 53 15 1 2483 538836121 538838632 0 4091
3 TraesCS7D01G335300 chr7D 97.925 1494 22 1 999 2483 112190211 112188718 0 2579
4 TraesCS7D01G335300 chr7D 95.131 1643 39 13 1 1603 445228995 445230636 0 2553
5 TraesCS7D01G335300 chr5D 97.532 2512 30 3 1 2483 422770438 422772946 0 4266
6 TraesCS7D01G335300 chr5D 97.268 2526 26 12 1 2483 52374457 52371932 0 4242
7 TraesCS7D01G335300 chr5D 96.978 2515 32 8 1 2483 282366336 282368838 0 4183
8 TraesCS7D01G335300 chr5D 96.732 2509 33 9 1 2483 356119426 356116941 0 4133
9 TraesCS7D01G335300 chr3D 97.569 2509 29 3 1 2483 52842512 52845014 0 4266
10 TraesCS7D01G335300 chr3D 98.721 938 12 0 1546 2483 534218112 534217175 0 1666
11 TraesCS7D01G335300 chr4D 97.342 2521 27 5 1 2483 392724776 392722258 0 4248
12 TraesCS7D01G335300 chr1A 94.422 2528 89 15 1 2483 20826401 20823881 0 3840
13 TraesCS7D01G335300 chr7A 94.069 2529 96 19 2 2483 731435222 731437743 0 3790
14 TraesCS7D01G335300 chr2D 94.414 1110 22 6 911 1981 36877812 36876704 0 1670


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G335300 chr7D 426834684 426837166 2482 True 4586 4586 100.000 1 2483 1 chr7D.!!$R2 2482
1 TraesCS7D01G335300 chr7D 634767912 634770417 2505 False 4252 4252 97.452 1 2483 1 chr7D.!!$F3 2482
2 TraesCS7D01G335300 chr7D 538836121 538838632 2511 False 4091 4091 96.267 1 2483 1 chr7D.!!$F2 2482
3 TraesCS7D01G335300 chr7D 112188718 112190211 1493 True 2579 2579 97.925 999 2483 1 chr7D.!!$R1 1484
4 TraesCS7D01G335300 chr7D 445228995 445230636 1641 False 2553 2553 95.131 1 1603 1 chr7D.!!$F1 1602
5 TraesCS7D01G335300 chr5D 422770438 422772946 2508 False 4266 4266 97.532 1 2483 1 chr5D.!!$F2 2482
6 TraesCS7D01G335300 chr5D 52371932 52374457 2525 True 4242 4242 97.268 1 2483 1 chr5D.!!$R1 2482
7 TraesCS7D01G335300 chr5D 282366336 282368838 2502 False 4183 4183 96.978 1 2483 1 chr5D.!!$F1 2482
8 TraesCS7D01G335300 chr5D 356116941 356119426 2485 True 4133 4133 96.732 1 2483 1 chr5D.!!$R2 2482
9 TraesCS7D01G335300 chr3D 52842512 52845014 2502 False 4266 4266 97.569 1 2483 1 chr3D.!!$F1 2482
10 TraesCS7D01G335300 chr3D 534217175 534218112 937 True 1666 1666 98.721 1546 2483 1 chr3D.!!$R1 937
11 TraesCS7D01G335300 chr4D 392722258 392724776 2518 True 4248 4248 97.342 1 2483 1 chr4D.!!$R1 2482
12 TraesCS7D01G335300 chr1A 20823881 20826401 2520 True 3840 3840 94.422 1 2483 1 chr1A.!!$R1 2482
13 TraesCS7D01G335300 chr7A 731435222 731437743 2521 False 3790 3790 94.069 2 2483 1 chr7A.!!$F1 2481
14 TraesCS7D01G335300 chr2D 36876704 36877812 1108 True 1670 1670 94.414 911 1981 1 chr2D.!!$R1 1070

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
490 495 3.389656 TCTTATGTGTGAGGTGTTGTGGA 59.61 43.478 0.0 0.0 0.0 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2391 2502 0.452184 CGACTAGCGAGGAGAAGCAA 59.548 55.0 0.0 0.0 44.57 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
490 495 3.389656 TCTTATGTGTGAGGTGTTGTGGA 59.610 43.478 0.00 0.0 0.00 4.02
514 519 7.127339 GGATGATATATATGGGGTTGGTACTGT 59.873 40.741 0.00 0.0 0.00 3.55
650 655 3.648067 ACTGACACTGGAAGGAGATTCAA 59.352 43.478 0.00 0.0 39.91 2.69
698 703 6.089417 GCAACTATTGTTAGTGGTTTTCATGC 59.911 38.462 0.00 0.0 38.69 4.06
1015 1046 5.067954 GTGGGTAGATGTGTTTAACCAAGT 58.932 41.667 0.00 0.0 38.32 3.16
1550 1604 2.435805 CTGGCCTAGCAATGAAGGAGTA 59.564 50.000 3.32 0.0 34.58 2.59
2085 2187 2.416972 GGATCGTCGTACCTCTTGCTTT 60.417 50.000 0.00 0.0 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
490 495 9.213777 CTACAGTACCAACCCCATATATATCAT 57.786 37.037 0.0 0.0 0.00 2.45
514 519 1.045407 ACCGTGTCAGGAGTTTGCTA 58.955 50.000 0.0 0.0 34.73 3.49
650 655 4.212716 TCTTACCGTAGTAGCACATCCAT 58.787 43.478 0.0 0.0 0.00 3.41
698 703 8.761497 CACTATGTACCACCAAATTAATCTACG 58.239 37.037 0.0 0.0 0.00 3.51
1015 1046 6.084060 TCTCCTCATGATACATATCCCACAA 58.916 40.000 0.0 0.0 31.71 3.33
1156 1187 2.092429 TCTGCCCATCCTGGTAATCAAC 60.092 50.000 0.0 0.0 35.17 3.18
1918 1993 8.421784 TCAGTGTCAGTAATCTTCAGTTTTAGT 58.578 33.333 0.0 0.0 0.00 2.24
2085 2187 1.080638 AGCCAAATCCCACCCAACTA 58.919 50.000 0.0 0.0 0.00 2.24
2391 2502 0.452184 CGACTAGCGAGGAGAAGCAA 59.548 55.000 0.0 0.0 44.57 3.91


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.