Multiple sequence alignment - TraesCS7D01G301600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G301600 chr7D 100.000 2341 0 0 1 2341 382087953 382090293 0 4324
1 TraesCS7D01G301600 chr7D 98.720 2344 24 3 1 2341 626713041 626710701 0 4157
2 TraesCS7D01G301600 chr7D 98.206 2341 39 3 1 2341 307034494 307032157 0 4087
3 TraesCS7D01G301600 chr7D 97.095 2341 60 5 1 2341 307161078 307163410 0 3940
4 TraesCS7D01G301600 chr7A 98.893 2348 17 5 1 2341 638509516 638507171 0 4183
5 TraesCS7D01G301600 chr6B 98.679 2347 25 2 1 2341 596603710 596601364 0 4157
6 TraesCS7D01G301600 chrUn 98.552 2348 26 4 1 2341 171006435 171008781 0 4141
7 TraesCS7D01G301600 chr1B 98.168 2347 34 5 1 2341 672539373 672541716 0 4087
8 TraesCS7D01G301600 chr5B 98.124 2345 37 3 1 2338 567278143 567280487 0 4080


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G301600 chr7D 382087953 382090293 2340 False 4324 4324 100.000 1 2341 1 chr7D.!!$F2 2340
1 TraesCS7D01G301600 chr7D 626710701 626713041 2340 True 4157 4157 98.720 1 2341 1 chr7D.!!$R2 2340
2 TraesCS7D01G301600 chr7D 307032157 307034494 2337 True 4087 4087 98.206 1 2341 1 chr7D.!!$R1 2340
3 TraesCS7D01G301600 chr7D 307161078 307163410 2332 False 3940 3940 97.095 1 2341 1 chr7D.!!$F1 2340
4 TraesCS7D01G301600 chr7A 638507171 638509516 2345 True 4183 4183 98.893 1 2341 1 chr7A.!!$R1 2340
5 TraesCS7D01G301600 chr6B 596601364 596603710 2346 True 4157 4157 98.679 1 2341 1 chr6B.!!$R1 2340
6 TraesCS7D01G301600 chrUn 171006435 171008781 2346 False 4141 4141 98.552 1 2341 1 chrUn.!!$F1 2340
7 TraesCS7D01G301600 chr1B 672539373 672541716 2343 False 4087 4087 98.168 1 2341 1 chr1B.!!$F1 2340
8 TraesCS7D01G301600 chr5B 567278143 567280487 2344 False 4080 4080 98.124 1 2338 1 chr5B.!!$F1 2337

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
778 784 0.673437 ACGGAAATGGCCTTGTTGTG 59.327 50.0 3.32 0.0 0.0 3.33 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2167 2182 3.824001 TCCCACCAAAAGATCAATCCA 57.176 42.857 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 2.897846 CGACACAACGCCAACCCA 60.898 61.111 0.00 0.0 0.00 4.51
113 114 2.580783 CCTTGAGATTCCCCCTTTACCA 59.419 50.000 0.00 0.0 0.00 3.25
583 589 3.607661 GCGATCTCGAGGACCCCC 61.608 72.222 13.56 0.0 43.02 5.40
778 784 0.673437 ACGGAAATGGCCTTGTTGTG 59.327 50.000 3.32 0.0 0.00 3.33
851 860 5.474532 GCCAATATGATCTTAATGAGGTGCA 59.525 40.000 5.47 0.0 0.00 4.57
871 880 2.232941 CAGGGCTTTGCATCTGACATTT 59.767 45.455 0.00 0.0 34.87 2.32
1324 1335 4.316823 TCCTGGGAGAGGTGGCGT 62.317 66.667 0.00 0.0 43.37 5.68
1812 1825 1.780806 TGAAATACGAACAACCGCGA 58.219 45.000 8.23 0.0 0.00 5.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 3.953775 CGAAGTGCCCCACCACCT 61.954 66.667 0.00 0.00 36.38 4.00
478 484 0.608640 GTCTTTTCGAGAGCCTCCCA 59.391 55.000 0.00 0.00 34.31 4.37
583 589 1.721926 GAGAGCGGTCTCGAGTTTTTG 59.278 52.381 27.10 0.66 44.02 2.44
851 860 2.226962 AATGTCAGATGCAAAGCCCT 57.773 45.000 0.00 0.00 0.00 5.19
871 880 1.600636 CGCAGAGGAAAGCCCAACA 60.601 57.895 0.00 0.00 37.41 3.33
1324 1335 0.902048 CCCTCAGCTCAGACTGGTGA 60.902 60.000 1.81 3.10 39.25 4.02
1812 1825 7.041780 GCATTCAAGTCGATCTATTACAACCAT 60.042 37.037 0.00 0.00 0.00 3.55
2167 2182 3.824001 TCCCACCAAAAGATCAATCCA 57.176 42.857 0.00 0.00 0.00 3.41
2171 2186 5.602145 AGAACATTTCCCACCAAAAGATCAA 59.398 36.000 0.00 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.