Multiple sequence alignment - TraesCS7D01G301500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G301500 chr7D 100.000 2235 0 0 1 2235 382089822 382087588 0 4128
1 TraesCS7D01G301500 chr7D 98.704 2238 23 4 1 2235 626711172 626713406 0 3967
2 TraesCS7D01G301500 chr7D 98.210 2235 38 2 1 2235 307032627 307034859 0 3904
3 TraesCS7D01G301500 chr7D 97.181 2235 55 5 1 2235 307162939 307160713 0 3771
4 TraesCS7D01G301500 chr7A 98.707 2242 21 4 1 2235 638507641 638509881 0 3973
5 TraesCS7D01G301500 chr6B 98.617 2241 24 3 1 2235 596601835 596604074 0 3960
6 TraesCS7D01G301500 chr4D 98.570 2237 28 3 1 2235 123401542 123399308 0 3951
7 TraesCS7D01G301500 chr1B 98.081 2241 34 5 1 2235 672541245 672539008 0 3892
8 TraesCS7D01G301500 chr5B 97.993 2242 38 3 1 2235 567280019 567277778 0 3884


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G301500 chr7D 382087588 382089822 2234 True 4128 4128 100.000 1 2235 1 chr7D.!!$R2 2234
1 TraesCS7D01G301500 chr7D 626711172 626713406 2234 False 3967 3967 98.704 1 2235 1 chr7D.!!$F2 2234
2 TraesCS7D01G301500 chr7D 307032627 307034859 2232 False 3904 3904 98.210 1 2235 1 chr7D.!!$F1 2234
3 TraesCS7D01G301500 chr7D 307160713 307162939 2226 True 3771 3771 97.181 1 2235 1 chr7D.!!$R1 2234
4 TraesCS7D01G301500 chr7A 638507641 638509881 2240 False 3973 3973 98.707 1 2235 1 chr7A.!!$F1 2234
5 TraesCS7D01G301500 chr6B 596601835 596604074 2239 False 3960 3960 98.617 1 2235 1 chr6B.!!$F1 2234
6 TraesCS7D01G301500 chr4D 123399308 123401542 2234 True 3951 3951 98.570 1 2235 1 chr4D.!!$R1 2234
7 TraesCS7D01G301500 chr1B 672539008 672541245 2237 True 3892 3892 98.081 1 2235 1 chr1B.!!$R1 2234
8 TraesCS7D01G301500 chr5B 567277778 567280019 2241 True 3884 3884 97.993 1 2235 1 chr5B.!!$R1 2234

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
545 549 0.902048 CCCTCAGCTCAGACTGGTGA 60.902 60.0 1.81 3.1 39.25 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1756 1771 2.580783 CCTTGAGATTCCCCCTTTACCA 59.419 50.0 0.0 0.0 0.0 3.25 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 58 7.041780 GCATTCAAGTCGATCTATTACAACCAT 60.042 37.037 0.00 0.00 0.00 3.55
545 549 0.902048 CCCTCAGCTCAGACTGGTGA 60.902 60.000 1.81 3.10 39.25 4.02
998 1004 1.600636 CGCAGAGGAAAGCCCAACA 60.601 57.895 0.00 0.00 37.41 3.33
1018 1024 2.226962 AATGTCAGATGCAAAGCCCT 57.773 45.000 0.00 0.00 0.00 5.19
1286 1296 1.721926 GAGAGCGGTCTCGAGTTTTTG 59.278 52.381 27.10 0.66 44.02 2.44
1391 1401 0.608640 GTCTTTTCGAGAGCCTCCCA 59.391 55.000 0.00 0.00 34.31 4.37
1811 1826 3.953775 CGAAGTGCCCCACCACCT 61.954 66.667 0.00 0.00 36.38 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 58 1.780806 TGAAATACGAACAACCGCGA 58.219 45.000 8.23 0.0 0.00 5.87
545 549 4.316823 TCCTGGGAGAGGTGGCGT 62.317 66.667 0.00 0.0 43.37 5.68
998 1004 2.232941 CAGGGCTTTGCATCTGACATTT 59.767 45.455 0.00 0.0 34.87 2.32
1018 1024 5.474532 GCCAATATGATCTTAATGAGGTGCA 59.525 40.000 5.47 0.0 0.00 4.57
1091 1101 0.673437 ACGGAAATGGCCTTGTTGTG 59.327 50.000 3.32 0.0 0.00 3.33
1286 1296 3.607661 GCGATCTCGAGGACCCCC 61.608 72.222 13.56 0.0 43.02 5.40
1756 1771 2.580783 CCTTGAGATTCCCCCTTTACCA 59.419 50.000 0.00 0.0 0.00 3.25
1811 1826 2.897846 CGACACAACGCCAACCCA 60.898 61.111 0.00 0.0 0.00 4.51
2122 2138 5.524646 ACGTAGTTTTTCGAAGTGAATTGGA 59.475 36.000 0.00 0.0 37.78 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.