Multiple sequence alignment - TraesCS7D01G301400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G301400 chr7D 100.000 2314 0 0 1 2314 382073379 382071066 0.000000e+00 4274
1 TraesCS7D01G301400 chr7D 99.136 2314 19 1 1 2314 626630213 626632525 0.000000e+00 4161
2 TraesCS7D01G301400 chr7D 99.136 2314 18 2 1 2314 626724465 626726776 0.000000e+00 4161
3 TraesCS7D01G301400 chr1D 99.006 2314 21 2 1 2314 212458839 212461150 0.000000e+00 4145
4 TraesCS7D01G301400 chr3D 98.617 2314 31 1 1 2314 602873032 602875344 0.000000e+00 4095
5 TraesCS7D01G301400 chr3D 98.980 98 1 0 2217 2314 572093126 572093029 2.360000e-40 176
6 TraesCS7D01G301400 chr4D 98.574 2314 31 2 1 2314 123545918 123543607 0.000000e+00 4089
7 TraesCS7D01G301400 chr4D 98.271 2314 38 2 1 2314 123388256 123385945 0.000000e+00 4050
8 TraesCS7D01G301400 chrUn 99.196 2239 16 1 1 2239 170995032 170992796 0.000000e+00 4034
9 TraesCS7D01G301400 chr7B 99.151 2239 18 1 1 2239 743095875 743098112 0.000000e+00 4028
10 TraesCS7D01G301400 chr7B 99.062 2239 20 1 1 2239 644446412 644448649 0.000000e+00 4017
11 TraesCS7D01G301400 chr6B 100.000 88 0 0 2227 2314 394408748 394408661 1.840000e-36 163


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G301400 chr7D 382071066 382073379 2313 True 4274 4274 100.000 1 2314 1 chr7D.!!$R1 2313
1 TraesCS7D01G301400 chr7D 626630213 626632525 2312 False 4161 4161 99.136 1 2314 1 chr7D.!!$F1 2313
2 TraesCS7D01G301400 chr7D 626724465 626726776 2311 False 4161 4161 99.136 1 2314 1 chr7D.!!$F2 2313
3 TraesCS7D01G301400 chr1D 212458839 212461150 2311 False 4145 4145 99.006 1 2314 1 chr1D.!!$F1 2313
4 TraesCS7D01G301400 chr3D 602873032 602875344 2312 False 4095 4095 98.617 1 2314 1 chr3D.!!$F1 2313
5 TraesCS7D01G301400 chr4D 123543607 123545918 2311 True 4089 4089 98.574 1 2314 1 chr4D.!!$R2 2313
6 TraesCS7D01G301400 chr4D 123385945 123388256 2311 True 4050 4050 98.271 1 2314 1 chr4D.!!$R1 2313
7 TraesCS7D01G301400 chrUn 170992796 170995032 2236 True 4034 4034 99.196 1 2239 1 chrUn.!!$R1 2238
8 TraesCS7D01G301400 chr7B 743095875 743098112 2237 False 4028 4028 99.151 1 2239 1 chr7B.!!$F2 2238
9 TraesCS7D01G301400 chr7B 644446412 644448649 2237 False 4017 4017 99.062 1 2239 1 chr7B.!!$F1 2238

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
504 505 2.859165 GGTGGTGAACCTCTCATTCA 57.141 50.0 0.37 0.0 46.55 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2212 2217 6.612863 TCCTCTGGATTCAATCTCAATGACTA 59.387 38.462 0.0 0.0 0.0 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
504 505 2.859165 GGTGGTGAACCTCTCATTCA 57.141 50.000 0.37 0.0 46.55 2.57
1058 1060 1.145156 CCCACACCTGTCACGTTCA 59.855 57.895 0.00 0.0 0.00 3.18
1435 1437 4.102524 TGGTCATTATAGCGGTTCCTTCAT 59.897 41.667 0.00 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
504 505 1.205893 GGTTCGGAGAGCACTGAAGAT 59.794 52.381 0.00 0.0 40.41 2.40
652 653 0.553333 GGAAGAAGGGGCCTAAGCAT 59.447 55.000 0.84 0.0 42.56 3.79
831 833 0.384309 CCACGCGAGCTGGTTAGATA 59.616 55.000 15.93 0.0 0.00 1.98
1058 1060 0.467384 CAGTTGAGGAGGCCGATCAT 59.533 55.000 8.18 0.0 0.00 2.45
2212 2217 6.612863 TCCTCTGGATTCAATCTCAATGACTA 59.387 38.462 0.00 0.0 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.