Multiple sequence alignment - TraesCS7D01G301200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G301200 chr7D 100.000 2594 0 0 1 2594 382050046 382052639 0.000000e+00 4791
1 TraesCS7D01G301200 chr7D 99.537 2594 11 1 1 2594 381923969 381926561 0.000000e+00 4723
2 TraesCS7D01G301200 chr7D 99.383 2594 15 1 1 2594 203499967 203502559 0.000000e+00 4700
3 TraesCS7D01G301200 chr7D 99.269 2599 10 3 1 2594 381973799 381971205 0.000000e+00 4686
4 TraesCS7D01G301200 chr5A 99.614 2594 10 0 1 2594 19248876 19246283 0.000000e+00 4735
5 TraesCS7D01G301200 chr7B 99.075 2594 17 3 1 2594 716878812 716876226 0.000000e+00 4650
6 TraesCS7D01G301200 chr7B 98.921 2595 20 4 1 2594 742989414 742992001 0.000000e+00 4630
7 TraesCS7D01G301200 chr7A 99.036 2594 19 2 1 2594 60279281 60281868 0.000000e+00 4647
8 TraesCS7D01G301200 chr7A 97.119 2430 60 6 1 2426 686650810 686648387 0.000000e+00 4091
9 TraesCS7D01G301200 chr3B 97.418 2595 57 4 1 2594 797592966 797590381 0.000000e+00 4412
10 TraesCS7D01G301200 chr2A 97.818 275 6 0 2320 2594 444322512 444322238 2.340000e-130 475


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G301200 chr7D 382050046 382052639 2593 False 4791 4791 100.000 1 2594 1 chr7D.!!$F3 2593
1 TraesCS7D01G301200 chr7D 381923969 381926561 2592 False 4723 4723 99.537 1 2594 1 chr7D.!!$F2 2593
2 TraesCS7D01G301200 chr7D 203499967 203502559 2592 False 4700 4700 99.383 1 2594 1 chr7D.!!$F1 2593
3 TraesCS7D01G301200 chr7D 381971205 381973799 2594 True 4686 4686 99.269 1 2594 1 chr7D.!!$R1 2593
4 TraesCS7D01G301200 chr5A 19246283 19248876 2593 True 4735 4735 99.614 1 2594 1 chr5A.!!$R1 2593
5 TraesCS7D01G301200 chr7B 716876226 716878812 2586 True 4650 4650 99.075 1 2594 1 chr7B.!!$R1 2593
6 TraesCS7D01G301200 chr7B 742989414 742992001 2587 False 4630 4630 98.921 1 2594 1 chr7B.!!$F1 2593
7 TraesCS7D01G301200 chr7A 60279281 60281868 2587 False 4647 4647 99.036 1 2594 1 chr7A.!!$F1 2593
8 TraesCS7D01G301200 chr7A 686648387 686650810 2423 True 4091 4091 97.119 1 2426 1 chr7A.!!$R1 2425
9 TraesCS7D01G301200 chr3B 797590381 797592966 2585 True 4412 4412 97.418 1 2594 1 chr3B.!!$R1 2593

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
23 24 2.353579 ACAGAGTTCGTTTTTGGGTTCG 59.646 45.455 0.0 0.0 0.0 3.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1818 1821 1.267261 GCACCTCAGTATACGATCGCT 59.733 52.381 16.6 5.44 0.0 4.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 2.353579 ACAGAGTTCGTTTTTGGGTTCG 59.646 45.455 0.00 0.00 0.00 3.95
1250 1253 7.958088 TCGATTGGACATGTAGGTTATATTCA 58.042 34.615 0.00 0.00 0.00 2.57
1818 1821 0.251653 AGGACTCCCAGTTACTGCGA 60.252 55.000 6.88 2.99 33.88 5.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 3.774599 ATCCATTCGGGGCTTCGGC 62.775 63.158 1.61 0.00 37.22 5.54
639 641 1.211949 GCAGCTACATGGACCCCTTTA 59.788 52.381 0.00 0.00 0.00 1.85
1250 1253 4.042809 TGGTTCCACATGAGAAACCAGTAT 59.957 41.667 9.86 0.00 29.44 2.12
1818 1821 1.267261 GCACCTCAGTATACGATCGCT 59.733 52.381 16.60 5.44 0.00 4.93


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.