Multiple sequence alignment - TraesCS7D01G301000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G301000 chr7D 100.000 2231 0 0 1 2231 381972091 381969861 0.000000e+00 4120
1 TraesCS7D01G301000 chr7D 99.238 2231 11 2 1 2231 382051758 382053982 0.000000e+00 4021
2 TraesCS7D01G301000 chr7D 99.148 2231 13 2 1 2231 381925680 381927904 0.000000e+00 4010
3 TraesCS7D01G301000 chr7D 98.790 2232 14 7 1 2231 203501678 203503897 0.000000e+00 3960
4 TraesCS7D01G301000 chr7D 96.721 61 1 1 2172 2231 626693989 626693929 1.410000e-17 100
5 TraesCS7D01G301000 chr6D 99.194 2232 12 2 1 2231 124519201 124521427 0.000000e+00 4017
6 TraesCS7D01G301000 chr6D 98.522 2233 24 3 2 2231 458899862 458902088 0.000000e+00 3932
7 TraesCS7D01G301000 chr1D 98.431 2231 29 2 1 2231 269408479 269410703 0.000000e+00 3921
8 TraesCS7D01G301000 chr7B 98.858 2189 16 2 1 2189 742991124 742993303 0.000000e+00 3895
9 TraesCS7D01G301000 chr7B 98.721 2190 17 3 1 2189 716877102 716874923 0.000000e+00 3879
10 TraesCS7D01G301000 chr7A 98.812 2189 16 2 1 2189 60280992 60283170 0.000000e+00 3890
11 TraesCS7D01G301000 chr3A 98.333 60 1 0 2172 2231 227648530 227648589 3.030000e-19 106
12 TraesCS7D01G301000 chr3A 96.721 61 1 1 2172 2231 653822319 653822259 1.410000e-17 100


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G301000 chr7D 381969861 381972091 2230 True 4120 4120 100.000 1 2231 1 chr7D.!!$R1 2230
1 TraesCS7D01G301000 chr7D 382051758 382053982 2224 False 4021 4021 99.238 1 2231 1 chr7D.!!$F3 2230
2 TraesCS7D01G301000 chr7D 381925680 381927904 2224 False 4010 4010 99.148 1 2231 1 chr7D.!!$F2 2230
3 TraesCS7D01G301000 chr7D 203501678 203503897 2219 False 3960 3960 98.790 1 2231 1 chr7D.!!$F1 2230
4 TraesCS7D01G301000 chr6D 124519201 124521427 2226 False 4017 4017 99.194 1 2231 1 chr6D.!!$F1 2230
5 TraesCS7D01G301000 chr6D 458899862 458902088 2226 False 3932 3932 98.522 2 2231 1 chr6D.!!$F2 2229
6 TraesCS7D01G301000 chr1D 269408479 269410703 2224 False 3921 3921 98.431 1 2231 1 chr1D.!!$F1 2230
7 TraesCS7D01G301000 chr7B 742991124 742993303 2179 False 3895 3895 98.858 1 2189 1 chr7B.!!$F1 2188
8 TraesCS7D01G301000 chr7B 716874923 716877102 2179 True 3879 3879 98.721 1 2189 1 chr7B.!!$R1 2188
9 TraesCS7D01G301000 chr7A 60280992 60283170 2178 False 3890 3890 98.812 1 2189 1 chr7A.!!$F1 2188

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1014 1022 1.012049 AGGGGGATGGATAAAGTGGGA 59.988 52.381 0.0 0.0 0.0 4.37 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1852 1865 1.974343 CCGATGGGGAAACGGCAAA 60.974 57.895 0.0 0.0 40.19 3.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1014 1022 1.012049 AGGGGGATGGATAAAGTGGGA 59.988 52.381 0.00 0.00 0.0 4.37
1852 1865 0.398522 TCCAGATACCGGTGCATCCT 60.399 55.000 19.93 3.72 0.0 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1014 1022 6.019640 CGATTGCAAAATGTGAGTCTGTTTTT 60.020 34.615 1.71 0.0 0.00 1.94
1852 1865 1.974343 CCGATGGGGAAACGGCAAA 60.974 57.895 0.00 0.0 40.19 3.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.