Multiple sequence alignment - TraesCS7D01G300900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G300900 chr7D 100.000 2440 0 0 1 2440 381925603 381923164 0 4506
1 TraesCS7D01G300900 chr6D 99.344 2440 14 1 1 2440 124519124 124516687 0 4416
2 TraesCS7D01G300900 chr5A 99.183 2447 11 5 1 2440 19247241 19249685 0 4399
3 TraesCS7D01G300900 chr1A 98.895 2443 18 5 1 2440 498689625 498692061 0 4353
4 TraesCS7D01G300900 chr4D 98.771 2441 27 3 1 2440 123337073 123334635 0 4338
5 TraesCS7D01G300900 chr1D 98.730 2440 27 3 1 2440 269408402 269405967 0 4331


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G300900 chr7D 381923164 381925603 2439 True 4506 4506 100.000 1 2440 1 chr7D.!!$R1 2439
1 TraesCS7D01G300900 chr6D 124516687 124519124 2437 True 4416 4416 99.344 1 2440 1 chr6D.!!$R1 2439
2 TraesCS7D01G300900 chr5A 19247241 19249685 2444 False 4399 4399 99.183 1 2440 1 chr5A.!!$F1 2439
3 TraesCS7D01G300900 chr1A 498689625 498692061 2436 False 4353 4353 98.895 1 2440 1 chr1A.!!$F1 2439
4 TraesCS7D01G300900 chr4D 123334635 123337073 2438 True 4338 4338 98.771 1 2440 1 chr4D.!!$R1 2439
5 TraesCS7D01G300900 chr1D 269405967 269408402 2435 True 4331 4331 98.730 1 2440 1 chr1D.!!$R1 2439

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
630 631 3.861846 ACCCTCATAGATATCAGGTGCA 58.138 45.455 5.32 0.0 0.0 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1587 1590 0.557729 AGCCCCGAATGGATTGGATT 59.442 50.0 0.0 0.0 37.49 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
630 631 3.861846 ACCCTCATAGATATCAGGTGCA 58.138 45.455 5.32 0.0 0.00 4.57
1234 1235 3.545124 AACGTCGGCAGGCATTCCA 62.545 57.895 0.00 0.0 33.74 3.53
1587 1590 0.662619 CGTTGGCAGAAGCAGAAACA 59.337 50.000 0.00 0.0 44.61 2.83
1980 1990 1.812571 CCCCCTTTTGAATCGACAGTG 59.187 52.381 0.00 0.0 0.00 3.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1331 1334 0.107703 TGTAATCCCTGCAGCTTCCG 60.108 55.000 8.66 0.00 0.00 4.30
1587 1590 0.557729 AGCCCCGAATGGATTGGATT 59.442 50.000 0.00 0.00 37.49 3.01
1904 1912 3.462954 TGCCTTGGATATGAGGAATTCCA 59.537 43.478 26.22 7.14 38.89 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.