Multiple sequence alignment - TraesCS7D01G300600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G300600 chr7D 100.000 2960 0 0 1 2960 381916948 381913989 0 5467
1 TraesCS7D01G300600 chr7D 99.392 2960 17 1 1 2960 203496969 203494011 0 5365
2 TraesCS7D01G300600 chr7D 99.257 2960 21 1 1 2960 381976792 381979750 0 5343
3 TraesCS7D01G300600 chr6D 99.527 2960 12 2 1 2960 124514494 124511537 0 5387
4 TraesCS7D01G300600 chr6D 98.378 2960 39 6 1 2960 283225566 283228516 0 5192
5 TraesCS7D01G300600 chr4A 98.851 2960 30 3 1 2960 67593748 67590793 0 5275
6 TraesCS7D01G300600 chr4D 98.650 2962 35 4 1 2960 123332440 123329482 0 5243
7 TraesCS7D01G300600 chr5A 98.615 2960 39 2 1 2960 238899802 238902759 0 5238
8 TraesCS7D01G300600 chr1B 98.279 2964 44 4 1 2960 672557169 672560129 0 5184


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G300600 chr7D 381913989 381916948 2959 True 5467 5467 100.000 1 2960 1 chr7D.!!$R2 2959
1 TraesCS7D01G300600 chr7D 203494011 203496969 2958 True 5365 5365 99.392 1 2960 1 chr7D.!!$R1 2959
2 TraesCS7D01G300600 chr7D 381976792 381979750 2958 False 5343 5343 99.257 1 2960 1 chr7D.!!$F1 2959
3 TraesCS7D01G300600 chr6D 124511537 124514494 2957 True 5387 5387 99.527 1 2960 1 chr6D.!!$R1 2959
4 TraesCS7D01G300600 chr6D 283225566 283228516 2950 False 5192 5192 98.378 1 2960 1 chr6D.!!$F1 2959
5 TraesCS7D01G300600 chr4A 67590793 67593748 2955 True 5275 5275 98.851 1 2960 1 chr4A.!!$R1 2959
6 TraesCS7D01G300600 chr4D 123329482 123332440 2958 True 5243 5243 98.650 1 2960 1 chr4D.!!$R1 2959
7 TraesCS7D01G300600 chr5A 238899802 238902759 2957 False 5238 5238 98.615 1 2960 1 chr5A.!!$F1 2959
8 TraesCS7D01G300600 chr1B 672557169 672560129 2960 False 5184 5184 98.279 1 2960 1 chr1B.!!$F1 2959

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
339 342 1.774639 TTCGTGTTACTTCGTCTGCC 58.225 50.0 1.66 0.0 0.0 4.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2125 2132 3.253432 GGTAAAAGAAGCCCACACTCAAG 59.747 47.826 0.0 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
274 277 5.667626 ACACCAGACATATCCCATACTTCTT 59.332 40.000 0.00 0.0 0.00 2.52
339 342 1.774639 TTCGTGTTACTTCGTCTGCC 58.225 50.000 1.66 0.0 0.00 4.85
765 768 6.723977 TGGCTACCAATAAAGATCCAAAACTT 59.276 34.615 0.00 0.0 0.00 2.66
1758 1765 6.769512 AGTAACAAAAGAAGATCCAGTGCTA 58.230 36.000 0.00 0.0 0.00 3.49
2092 2099 5.333035 GCGTTTGAAATAAACAAAAGGCTCC 60.333 40.000 0.00 0.0 38.63 4.70
2125 2132 7.581476 TCTGGAAAAGAATCGTCAATGTTTAC 58.419 34.615 0.00 0.0 29.54 2.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
339 342 2.570169 CGCATTCGTGTACAAACAAGG 58.430 47.619 0.00 0.00 37.36 3.61
954 961 5.464030 AACCGCAGTAAGGATACGAATAT 57.536 39.130 0.00 0.00 46.39 1.28
1724 1731 8.855804 ATCTTCTTTTGTTACTCCCCTATCTA 57.144 34.615 0.00 0.00 0.00 1.98
1758 1765 5.648330 ACCCTTGACCTTTCTTAAGAACT 57.352 39.130 17.51 3.37 33.13 3.01
2092 2099 6.369890 TGACGATTCTTTTCCAGAAATCTCAG 59.630 38.462 0.00 0.00 45.06 3.35
2125 2132 3.253432 GGTAAAAGAAGCCCACACTCAAG 59.747 47.826 0.00 0.00 0.00 3.02
2435 2442 3.009723 GTTGAGGATGATCGGCAGAAAA 58.990 45.455 0.00 0.00 0.00 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.