AutoCloner

Multiple sequence alignment - TraesCS7D01G299700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS7D01G299700	chr7D	100.000	4349	0	0	1	4349	379771204	379766856	0.000000e+00	8032.0
1	TraesCS7D01G299700	chr7D	85.683	454	59	4	311	762	465162021	465162470	1.420000e-129	473.0
2	TraesCS7D01G299700	chr7D	87.980	391	38	4	1	382	585195337	585194947	1.840000e-123	453.0
3	TraesCS7D01G299700	chr7D	96.875	96	2	1	1610	1705	426558893	426558987	4.500000e-35	159.0
4	TraesCS7D01G299700	chr7D	96.809	94	2	1	1614	1707	22964254	22964346	5.820000e-34	156.0
5	TraesCS7D01G299700	chr7A	94.234	1318	42	5	2394	3682	428339510	428338198	0.000000e+00	1982.0
6	TraesCS7D01G299700	chr7A	95.405	740	29	2	883	1618	428340820	428340082	0.000000e+00	1173.0
7	TraesCS7D01G299700	chr7A	93.678	348	13	4	1894	2235	428339853	428339509	3.000000e-141	512.0
8	TraesCS7D01G299700	chr7A	84.806	283	27	8	3684	3963	428338160	428337891	1.990000e-68	270.0
9	TraesCS7D01G299700	chr7A	88.835	206	12	4	4079	4275	428333735	428333532	4.350000e-60	243.0
10	TraesCS7D01G299700	chr7A	95.652	92	3	1	1527	1618	428340058	428339968	3.500000e-31	147.0
11	TraesCS7D01G299700	chr7A	93.000	100	6	1	1731	1830	428339946	428339848	1.260000e-30	145.0
12	TraesCS7D01G299700	chr7A	95.062	81	3	1	4270	4349	428331212	428331132	4.570000e-25	126.0
13	TraesCS7D01G299700	chr7B	93.455	825	43	6	2864	3682	374775092	374774273	0.000000e+00	1214.0
14	TraesCS7D01G299700	chr7B	97.154	492	14	0	898	1389	374802767	374802276	0.000000e+00	832.0
15	TraesCS7D01G299700	chr7B	92.647	544	12	5	1699	2235	374776112	374775590	0.000000e+00	758.0
16	TraesCS7D01G299700	chr7B	94.292	473	26	1	2394	2865	374775591	374775119	0.000000e+00	723.0
17	TraesCS7D01G299700	chr7B	84.095	591	68	14	1	579	582657576	582658152	8.220000e-152	547.0
18	TraesCS7D01G299700	chr7B	94.068	236	13	1	1384	1618	374776345	374776110	1.490000e-94	357.0
19	TraesCS7D01G299700	chr7B	82.878	403	33	12	3933	4316	374773698	374773313	3.240000e-86	329.0
20	TraesCS7D01G299700	chr7B	92.553	94	6	1	3680	3772	374774236	374774143	2.730000e-27	134.0
21	TraesCS7D01G299700	chr3D	86.667	765	79	13	1	761	402498309	402497564	0.000000e+00	826.0
22	TraesCS7D01G299700	chr3D	85.825	776	88	7	1	758	517293658	517294429	0.000000e+00	804.0
23	TraesCS7D01G299700	chr3D	85.268	448	46	10	1	432	549352587	549353030	1.110000e-120	444.0
24	TraesCS7D01G299700	chr3D	94.083	169	10	0	2231	2399	595025140	595024972	1.550000e-64	257.0
25	TraesCS7D01G299700	chr3D	91.713	181	14	1	2216	2395	612268629	612268449	2.600000e-62	250.0
26	TraesCS7D01G299700	chr3D	83.645	214	27	4	3840	4046	169450401	169450189	1.230000e-45	195.0
27	TraesCS7D01G299700	chr3D	92.453	106	6	2	1608	1711	459472532	459472427	2.710000e-32	150.0
28	TraesCS7D01G299700	chr3B	86.180	767	85	9	1	750	489718380	489719142	0.000000e+00	809.0
29	TraesCS7D01G299700	chr3B	87.195	164	20	1	3883	4046	759028105	759028267	7.430000e-43	185.0
30	TraesCS7D01G299700	chr3B	82.589	224	23	4	3838	4045	511628731	511628954	2.670000e-42	183.0
31	TraesCS7D01G299700	chr3B	92.453	106	4	3	1616	1718	302899604	302899500	9.740000e-32	148.0
32	TraesCS7D01G299700	chr2D	85.733	764	91	8	1	750	555477151	555476392	0.000000e+00	791.0
33	TraesCS7D01G299700	chr2D	83.007	765	116	12	1	761	44529502	44530256	0.000000e+00	680.0
34	TraesCS7D01G299700	chr2D	85.202	446	60	4	314	757	517258905	517258464	1.840000e-123	453.0
35	TraesCS7D01G299700	chr2D	95.092	163	8	0	2233	2395	362930970	362930808	1.550000e-64	257.0
36	TraesCS7D01G299700	chr2D	84.541	207	30	2	3838	4043	119558282	119558077	2.050000e-48	204.0
37	TraesCS7D01G299700	chr2D	82.692	208	30	4	3842	4043	349584562	349584769	3.460000e-41	180.0
38	TraesCS7D01G299700	chr2D	96.842	95	3	0	1611	1705	601266051	601266145	4.500000e-35	159.0
39	TraesCS7D01G299700	chr2A	85.477	723	93	4	1	720	26767327	26768040	0.000000e+00	743.0
40	TraesCS7D01G299700	chr4B	83.592	774	106	12	2	759	614126849	614127617	0.000000e+00	706.0
41	TraesCS7D01G299700	chr4B	95.062	162	8	0	2234	2395	135218210	135218049	5.580000e-64	255.0
42	TraesCS7D01G299700	chr4B	86.127	173	20	4	3879	4050	411490572	411490741	2.670000e-42	183.0
43	TraesCS7D01G299700	chr2B	83.745	769	102	14	1	758	747604530	747603774	0.000000e+00	706.0
44	TraesCS7D01G299700	chr2B	82.938	211	31	3	3838	4043	682945443	682945653	7.430000e-43	185.0
45	TraesCS7D01G299700	chrUn	82.745	765	118	12	1	761	399659863	399660617	0.000000e+00	669.0
46	TraesCS7D01G299700	chrUn	91.160	181	14	2	2216	2395	34210735	34210914	1.210000e-60	244.0
47	TraesCS7D01G299700	chr4D	86.010	629	72	7	143	759	483674676	483675300	0.000000e+00	660.0
48	TraesCS7D01G299700	chr1B	86.567	402	45	1	1	393	410309221	410308820	6.680000e-118	435.0
49	TraesCS7D01G299700	chr1B	93.529	170	11	0	2226	2395	652464936	652464767	2.010000e-63	254.0
50	TraesCS7D01G299700	chr1B	84.722	72	8	1	4069	4137	156962742	156962813	7.800000e-08	69.4
51	TraesCS7D01G299700	chr4A	94.578	166	9	0	2233	2398	517406633	517406468	1.550000e-64	257.0
52	TraesCS7D01G299700	chr4A	93.269	104	5	2	1605	1708	69329844	69329945	7.530000e-33	152.0
53	TraesCS7D01G299700	chr4A	94.286	35	2	0	4186	4220	484836554	484836588	2.000000e-03	54.7
54	TraesCS7D01G299700	chr5D	95.597	159	7	0	2234	2392	542693295	542693453	5.580000e-64	255.0
55	TraesCS7D01G299700	chr1D	94.048	168	10	0	2228	2395	338937206	338937373	5.580000e-64	255.0
56	TraesCS7D01G299700	chr1D	82.870	216	28	5	3838	4045	26259152	26258938	7.430000e-43	185.0
57	TraesCS7D01G299700	chr5B	83.732	209	32	2	3838	4046	663242368	663242162	3.430000e-46	196.0
58	TraesCS7D01G299700	chr5B	81.046	153	24	4	4072	4220	390703512	390703361	2.750000e-22	117.0
59	TraesCS7D01G299700	chr3A	83.019	212	23	7	3840	4043	197850721	197850927	3.460000e-41	180.0
60	TraesCS7D01G299700	chr6D	95.876	97	4	0	1611	1707	62245407	62245311	1.620000e-34	158.0
61	TraesCS7D01G299700	chr6B	94.000	100	4	2	1609	1708	14523413	14523316	2.710000e-32	150.0
62	TraesCS7D01G299700	chr6A	94.737	95	4	1	1609	1703	557970041	557970134	3.500000e-31	147.0

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS7D01G299700	chr7D	379766856	379771204	4348	True	8032.000000	8032	100.000000	1	4349	1	chr7D.!!$R1	4348
1	TraesCS7D01G299700	chr7A	428337891	428340820	2929	True	704.833333	1982	92.795833	883	3963	6	chr7A.!!$R2	3080
2	TraesCS7D01G299700	chr7B	374773313	374776345	3032	True	585.833333	1214	91.648833	1384	4316	6	chr7B.!!$R2	2932
3	TraesCS7D01G299700	chr7B	582657576	582658152	576	False	547.000000	547	84.095000	1	579	1	chr7B.!!$F1	578
4	TraesCS7D01G299700	chr3D	402497564	402498309	745	True	826.000000	826	86.667000	1	761	1	chr3D.!!$R2	760
5	TraesCS7D01G299700	chr3D	517293658	517294429	771	False	804.000000	804	85.825000	1	758	1	chr3D.!!$F1	757
6	TraesCS7D01G299700	chr3B	489718380	489719142	762	False	809.000000	809	86.180000	1	750	1	chr3B.!!$F1	749
7	TraesCS7D01G299700	chr2D	555476392	555477151	759	True	791.000000	791	85.733000	1	750	1	chr2D.!!$R4	749
8	TraesCS7D01G299700	chr2D	44529502	44530256	754	False	680.000000	680	83.007000	1	761	1	chr2D.!!$F1	760
9	TraesCS7D01G299700	chr2A	26767327	26768040	713	False	743.000000	743	85.477000	1	720	1	chr2A.!!$F1	719
10	TraesCS7D01G299700	chr4B	614126849	614127617	768	False	706.000000	706	83.592000	2	759	1	chr4B.!!$F2	757
11	TraesCS7D01G299700	chr2B	747603774	747604530	756	True	706.000000	706	83.745000	1	758	1	chr2B.!!$R1	757
12	TraesCS7D01G299700	chrUn	399659863	399660617	754	False	669.000000	669	82.745000	1	761	1	chrUn.!!$F2	760
13	TraesCS7D01G299700	chr4D	483674676	483675300	624	False	660.000000	660	86.010000	143	759	1	chr4D.!!$F1	616

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
580	637	0.027324	TACGCCGCGTTTTCGTTTTT	59.973	45.0	25.47	0.00	46.03	1.94	F
721	779	0.040351	TCCATTTTCATCCCGCCCAA	59.960	50.0	0.00	0.00	0.00	4.12	F
1631	1695	0.042131	AATGTACTCCCTCCGTCCCA	59.958	55.0	0.00	0.00	0.00	4.37	F
1963	2135	0.249657	TTGTGGTTGCGAATTTGCCC	60.250	50.0	15.20	10.25	0.00	5.36	F
1998	2170	0.593128	ATTTGTCGCCAACTGTGCTC	59.407	50.0	0.00	0.00	0.00	4.26	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Hairpin	End Stability	Orientation
2038	2211	0.613777	AGAAAGTTACAGGGAGGGCG	59.386	55.0	0.00	0.00	6.13	R
2683	2888	0.319813	GTGGCCACCTTTGTTGCATC	60.320	55.0	26.31	34.91	3.91	R
2844	3050	0.394192	CCTCACAGTGACAGGCTCAA	59.606	55.0	0.00	0.00	3.02	R
3151	3386	0.541764	GCCCTGGTTCCCATGTTCAA	60.542	55.0	0.00	30.82	2.69	R
3762	4042	1.338107	CCCTTTTCACCAAGTTCCCC	58.662	55.0	0.00	0.00	4.81	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
49	50	2.089201	TCTCATTCCGACGAACAGCTA	58.911	47.619	0.00	0.00	0.00	3.32
69	70	6.713903	CAGCTATCTTATGGACCAACATGATT	59.286	38.462	0.00	0.00	32.39	2.57
149	150	2.002586	CACAACCTAAGCGACATCCAG	58.997	52.381	0.00	0.00	0.00	3.86
230	244	4.040198	GAGGAGGGGGAGGGGGTT	62.040	72.222	0.00	0.00	0.00	4.11
249	263	3.534721	GCTTACCAGCTTCGAGGTT	57.465	52.632	0.00	0.00	43.51	3.50
337	386	4.400961	GCTCCTGCCGCCTCTTGT	62.401	66.667	0.00	0.00	0.00	3.16
362	411	3.075005	GGGGAGTGTCGCAGCCTA	61.075	66.667	0.00	0.00	0.00	3.93
484	537	0.701731	TAAATGGGGTGGTGAGGGTG	59.298	55.000	0.00	0.00	0.00	4.61
580	637	0.027324	TACGCCGCGTTTTCGTTTTT	59.973	45.000	25.47	0.00	46.03	1.94
590	647	1.104630	TTTCGTTTTTCGCCCCACTT	58.895	45.000	0.00	0.00	39.67	3.16
702	759	1.526575	CCTGCAGGCAACCAAACGAT	61.527	55.000	22.33	0.00	37.17	3.73
715	773	3.447229	ACCAAACGATCCATTTTCATCCC	59.553	43.478	0.00	0.00	0.00	3.85
720	778	0.261402	ATCCATTTTCATCCCGCCCA	59.739	50.000	0.00	0.00	0.00	5.36
721	779	0.040351	TCCATTTTCATCCCGCCCAA	59.960	50.000	0.00	0.00	0.00	4.12
761	820	1.740296	CCACCAAACGCGTCCCTAG	60.740	63.158	14.44	2.77	0.00	3.02
762	821	2.047560	ACCAAACGCGTCCCTAGC	60.048	61.111	14.44	0.00	0.00	3.42
769	828	4.827481	GCGTCCCTAGCGATCAAA	57.173	55.556	0.00	0.00	0.00	2.69
770	829	3.059603	GCGTCCCTAGCGATCAAAA	57.940	52.632	0.00	0.00	0.00	2.44
771	830	1.365699	GCGTCCCTAGCGATCAAAAA	58.634	50.000	0.00	0.00	0.00	1.94
825	884	8.980481	AAAAGAAAAACTAAGGAGAGATCACA	57.020	30.769	0.00	0.00	0.00	3.58
826	885	9.579932	AAAAGAAAAACTAAGGAGAGATCACAT	57.420	29.630	0.00	0.00	0.00	3.21
827	886	8.785329	AAGAAAAACTAAGGAGAGATCACATC	57.215	34.615	0.00	0.00	0.00	3.06
828	887	8.144862	AGAAAAACTAAGGAGAGATCACATCT	57.855	34.615	0.00	0.00	43.70	2.90
829	888	9.261035	AGAAAAACTAAGGAGAGATCACATCTA	57.739	33.333	0.00	0.00	40.38	1.98
830	889	9.877178	GAAAAACTAAGGAGAGATCACATCTAA	57.123	33.333	0.00	0.00	40.38	2.10

Showing 1 to 25 of 271 entries

Previous1 2 3 4 5…11Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
49	50	6.040166	GCTTGAATCATGTTGGTCCATAAGAT	59.960	38.462	0.00	0.00	0.00	2.40
69	70	1.055849	TAGCTGTGGTTCAGGCTTGA	58.944	50.000	0.00	0.00	43.78	3.02
149	150	1.498865	CGCCATCGCTAACCACATCC	61.499	60.000	0.00	0.00	0.00	3.51
249	263	1.685765	CTCCGTCATGTCTCCCCCA	60.686	63.158	0.00	0.00	0.00	4.96
337	386	2.431683	GACACTCCCCTGCAGCAA	59.568	61.111	8.66	0.00	0.00	3.91
361	410	1.469251	GCGGCGACAACTCAGATCTTA	60.469	52.381	12.98	0.00	0.00	2.10
362	411	0.737715	GCGGCGACAACTCAGATCTT	60.738	55.000	12.98	0.00	0.00	2.40
484	537	3.514362	CGGGGTGGCGCCAAATAC	61.514	66.667	34.66	19.31	39.65	1.89
509	564	1.580066	ATGGCGGGAGGGGAAAATCA	61.580	55.000	0.00	0.00	0.00	2.57
571	628	1.104630	AAGTGGGGCGAAAAACGAAA	58.895	45.000	0.00	0.00	45.77	3.46
580	637	1.192146	AGTCAAGCTAAGTGGGGCGA	61.192	55.000	0.00	0.00	0.00	5.54
590	647	0.108615	GCTTCCAGCGAGTCAAGCTA	60.109	55.000	5.19	0.00	44.06	3.32
624	681	3.991725	GAGCCTGGCTTGCTGGGAG	62.992	68.421	24.26	0.00	39.88	4.30
702	759	0.040351	TTGGGCGGGATGAAAATGGA	59.960	50.000	0.00	0.00	0.00	3.41
720	778	1.614317	GCATACAGCTCAACCAGGGTT	60.614	52.381	0.00	0.00	41.15	4.11
721	779	0.035056	GCATACAGCTCAACCAGGGT	60.035	55.000	0.00	0.00	41.15	4.34
745	803	2.047560	GCTAGGGACGCGTTTGGT	60.048	61.111	15.53	0.83	0.00	3.67
746	804	3.186047	CGCTAGGGACGCGTTTGG	61.186	66.667	15.53	5.75	45.13	3.28
799	858	9.408648	TGTGATCTCTCCTTAGTTTTTCTTTTT	57.591	29.630	0.00	0.00	0.00	1.94
800	859	8.980481	TGTGATCTCTCCTTAGTTTTTCTTTT	57.020	30.769	0.00	0.00	0.00	2.27
801	860	9.225436	GATGTGATCTCTCCTTAGTTTTTCTTT	57.775	33.333	0.00	0.00	0.00	2.52
802	861	8.601546	AGATGTGATCTCTCCTTAGTTTTTCTT	58.398	33.333	0.00	0.00	33.42	2.52
803	862	8.144862	AGATGTGATCTCTCCTTAGTTTTTCT	57.855	34.615	0.00	0.00	33.42	2.52
804	863	9.877178	TTAGATGTGATCTCTCCTTAGTTTTTC	57.123	33.333	0.00	0.00	40.76	2.29
808	867	8.646900	GGATTTAGATGTGATCTCTCCTTAGTT	58.353	37.037	0.00	0.00	40.76	2.24

Showing 1 to 25 of 260 entries

Previous1 2 3 4 5…11Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.