Multiple sequence alignment - TraesCS7D01G297300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G297300 chr7D 100.000 2531 0 0 1 2531 376016789 376014259 0 4674
1 TraesCS7D01G297300 chr7D 94.490 2541 129 5 1 2531 438129543 438127004 0 3906
2 TraesCS7D01G297300 chr2D 94.805 2541 115 8 1 2531 52081965 52084498 0 3945
3 TraesCS7D01G297300 chr2D 94.654 2544 121 7 1 2531 583243435 583245976 0 3930
4 TraesCS7D01G297300 chr2D 94.486 2539 128 7 1 2529 342701650 342704186 0 3903
5 TraesCS7D01G297300 chr2D 93.821 2541 146 5 1 2531 224181789 224184328 0 3812
6 TraesCS7D01G297300 chr2D 93.635 2545 143 11 1 2531 111073143 111075682 0 3784
7 TraesCS7D01G297300 chr5D 94.171 2539 138 4 1 2529 465599666 465602204 0 3860
8 TraesCS7D01G297300 chr5D 93.937 2540 137 9 5 2531 31039148 31036613 0 3821
9 TraesCS7D01G297300 chr1D 93.981 2542 139 7 1 2531 82165838 82168376 0 3834


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G297300 chr7D 376014259 376016789 2530 True 4674 4674 100.000 1 2531 1 chr7D.!!$R1 2530
1 TraesCS7D01G297300 chr7D 438127004 438129543 2539 True 3906 3906 94.490 1 2531 1 chr7D.!!$R2 2530
2 TraesCS7D01G297300 chr2D 52081965 52084498 2533 False 3945 3945 94.805 1 2531 1 chr2D.!!$F1 2530
3 TraesCS7D01G297300 chr2D 583243435 583245976 2541 False 3930 3930 94.654 1 2531 1 chr2D.!!$F5 2530
4 TraesCS7D01G297300 chr2D 342701650 342704186 2536 False 3903 3903 94.486 1 2529 1 chr2D.!!$F4 2528
5 TraesCS7D01G297300 chr2D 224181789 224184328 2539 False 3812 3812 93.821 1 2531 1 chr2D.!!$F3 2530
6 TraesCS7D01G297300 chr2D 111073143 111075682 2539 False 3784 3784 93.635 1 2531 1 chr2D.!!$F2 2530
7 TraesCS7D01G297300 chr5D 465599666 465602204 2538 False 3860 3860 94.171 1 2529 1 chr5D.!!$F1 2528
8 TraesCS7D01G297300 chr5D 31036613 31039148 2535 True 3821 3821 93.937 5 2531 1 chr5D.!!$R1 2526
9 TraesCS7D01G297300 chr1D 82165838 82168376 2538 False 3834 3834 93.981 1 2531 1 chr1D.!!$F1 2530

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
993 1004 0.107945 GTGCTCACTCCAGACCCATC 60.108 60.0 0.0 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1928 1949 0.179032 TTTCTGCTCCTTGGCACGAA 60.179 50.0 0.0 0.0 37.29 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 51 2.523168 TCGCTCTCCACACACCCA 60.523 61.111 0.00 0.00 0.00 4.51
119 120 4.363990 CTGACACAGGAGGCGCGT 62.364 66.667 8.43 0.27 0.00 6.01
244 245 1.214589 GAACTGGAGCGGCGAGTTA 59.785 57.895 12.98 0.00 44.27 2.24
277 278 2.361104 GATTGGGGCGGCAACTGA 60.361 61.111 12.47 0.00 0.00 3.41
573 578 2.162608 CCGGTGTTGCATTTAATTCCGA 59.837 45.455 0.00 0.00 39.17 4.55
713 720 2.167693 ACTATTCGATTTGACAGCGGGA 59.832 45.455 0.00 0.00 0.00 5.14
796 804 0.396139 ACGGCCAATGATGCATCCTT 60.396 50.000 23.67 17.19 0.00 3.36
810 821 6.322969 TGATGCATCCTTCTTCAATTAGCATT 59.677 34.615 23.67 0.00 39.94 3.56
898 909 4.094887 CGCAGTTTGCACTCATATAAAGGT 59.905 41.667 1.69 0.00 45.36 3.50
993 1004 0.107945 GTGCTCACTCCAGACCCATC 60.108 60.000 0.00 0.00 0.00 3.51
1216 1230 2.363795 CCGTACTCCTCCAGCCCA 60.364 66.667 0.00 0.00 0.00 5.36
1217 1231 1.762460 CCGTACTCCTCCAGCCCAT 60.762 63.158 0.00 0.00 0.00 4.00
1329 1343 1.066430 GCCACGAAGAATGTCCACCTA 60.066 52.381 0.00 0.00 0.00 3.08
1374 1388 0.605319 TCGCCCTGCAAGAATTCGTT 60.605 50.000 0.00 0.00 34.07 3.85
1624 1638 1.056660 CCTCCTGTAACCACCACTGT 58.943 55.000 0.00 0.00 0.00 3.55
1638 1652 0.231534 CACTGTGATCGCATCATCGC 59.768 55.000 9.87 0.00 42.04 4.58
1754 1768 9.408069 CTAGTACTCCATCCGTCAATTTATAAC 57.592 37.037 0.00 0.00 0.00 1.89
1860 1881 0.880718 GATGCGCCAACCTAGCTACC 60.881 60.000 4.18 0.00 0.00 3.18
1880 1901 1.754803 CACGTACCCTGCTTATCTGGA 59.245 52.381 0.00 0.00 35.98 3.86
1919 1940 4.351131 AGCGTTTCCAATCGTTATTTCC 57.649 40.909 0.00 0.00 0.00 3.13
1928 1949 6.755206 TCCAATCGTTATTTCCATCTATCGT 58.245 36.000 0.00 0.00 0.00 3.73
1947 1968 0.179032 TTCGTGCCAAGGAGCAGAAA 60.179 50.000 0.00 0.00 45.14 2.52
1949 1970 1.856265 CGTGCCAAGGAGCAGAAACC 61.856 60.000 0.00 0.00 45.14 3.27
2000 2021 8.439172 TCTACTCCTACTCCTATAAAAGACTCC 58.561 40.741 0.00 0.00 0.00 3.85
2011 2032 3.485463 AAAAGACTCCGTTGGTGATGA 57.515 42.857 0.00 0.00 0.00 2.92
2338 2360 1.452145 GAAAAGGCCTGCCACGTTCA 61.452 55.000 5.69 0.00 38.92 3.18
2470 2493 0.034198 TTGAGCGAACCGACCATTGA 59.966 50.000 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 51 1.296068 GCAGGCAGAGACAGAAGCT 59.704 57.895 0.00 0.00 0.00 3.74
103 104 4.357947 GACGCGCCTCCTGTGTCA 62.358 66.667 5.73 0.00 44.26 3.58
128 129 1.802636 GTACCGCGCCACTAGTGTA 59.197 57.895 21.18 3.46 0.00 2.90
488 492 2.359967 GGCCAAGCTCCTACCGTCT 61.360 63.158 0.00 0.00 0.00 4.18
517 521 3.677976 CGTCCGCCCTCAGTTTAAACTAT 60.678 47.826 20.15 0.00 37.08 2.12
562 567 2.702592 TGAGCGGGTCGGAATTAAAT 57.297 45.000 2.41 0.00 0.00 1.40
713 720 2.499685 GTATCGGGAACTGCGCCT 59.500 61.111 4.18 0.00 32.53 5.52
810 821 0.038599 ACTTCCCTCATGCATGCACA 59.961 50.000 25.37 11.98 0.00 4.57
898 909 1.381599 GCATTGGAATGGAGGGGCA 60.382 57.895 1.67 0.00 36.90 5.36
1225 1239 2.274760 GGCAGGCAATGAGGAGCT 59.725 61.111 0.00 0.00 0.00 4.09
1374 1388 3.119280 CGTACATGTGGATGTGTAGGTCA 60.119 47.826 9.11 0.00 43.03 4.02
1548 1562 0.247736 CCTCCTCAACTTAGTGCGCT 59.752 55.000 9.73 4.58 0.00 5.92
1638 1652 4.900635 AGCACAATAAGAATTAAGGCCG 57.099 40.909 0.00 0.00 32.17 6.13
1674 1688 1.062587 GCACATGTCGGTATTGACTGC 59.937 52.381 0.00 0.00 39.64 4.40
1754 1768 3.976942 CGAAGTTGATGGAAAAGCACAAG 59.023 43.478 0.00 0.00 0.00 3.16
1786 1805 2.040278 AGTGTTTCTAGCAAGATGCCCA 59.960 45.455 0.00 0.00 46.52 5.36
1814 1833 2.261671 GTCACATGCGGTCCGACT 59.738 61.111 17.49 0.00 0.00 4.18
1880 1901 1.074014 TAGGGCGGGGCTATTTCCT 60.074 57.895 0.00 0.00 0.00 3.36
1919 1940 1.860950 CCTTGGCACGAACGATAGATG 59.139 52.381 0.14 0.00 41.38 2.90
1928 1949 0.179032 TTTCTGCTCCTTGGCACGAA 60.179 50.000 0.00 0.00 37.29 3.85
2000 2021 1.464608 GACACACCATCATCACCAACG 59.535 52.381 0.00 0.00 0.00 4.10
2309 2331 2.610479 GCAGGCCTTTTCCTTTTACTGC 60.610 50.000 0.00 0.00 42.46 4.40
2422 2445 3.006752 TCCCACATGAAAGTGAAAATGCC 59.993 43.478 0.00 0.00 42.05 4.40
2457 2480 1.950909 TGGTTTGTCAATGGTCGGTTC 59.049 47.619 0.00 0.00 0.00 3.62
2470 2493 4.906537 GGGCGGGGTGTGGTTTGT 62.907 66.667 0.00 0.00 0.00 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.