Multiple sequence alignment - TraesCS7D01G295200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G295200 chr7D 100.000 2586 0 0 1 2586 369872045 369874630 0 4776
1 TraesCS7D01G295200 chr7D 98.072 2593 41 7 1 2586 611022519 611025109 0 4503
2 TraesCS7D01G295200 chr7D 97.953 2589 50 3 1 2586 251579414 251576826 0 4484
3 TraesCS7D01G295200 chr7D 97.876 2589 48 7 1 2586 414301596 414304180 0 4470
4 TraesCS7D01G295200 chr5D 98.185 2589 43 4 1 2586 212869873 212872460 0 4518
5 TraesCS7D01G295200 chr3D 97.914 2589 51 3 1 2586 213976087 213973499 0 4479
6 TraesCS7D01G295200 chr4D 97.759 2588 49 6 1 2586 52459301 52461881 0 4449


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G295200 chr7D 369872045 369874630 2585 False 4776 4776 100.000 1 2586 1 chr7D.!!$F1 2585
1 TraesCS7D01G295200 chr7D 611022519 611025109 2590 False 4503 4503 98.072 1 2586 1 chr7D.!!$F3 2585
2 TraesCS7D01G295200 chr7D 251576826 251579414 2588 True 4484 4484 97.953 1 2586 1 chr7D.!!$R1 2585
3 TraesCS7D01G295200 chr7D 414301596 414304180 2584 False 4470 4470 97.876 1 2586 1 chr7D.!!$F2 2585
4 TraesCS7D01G295200 chr5D 212869873 212872460 2587 False 4518 4518 98.185 1 2586 1 chr5D.!!$F1 2585
5 TraesCS7D01G295200 chr3D 213973499 213976087 2588 True 4479 4479 97.914 1 2586 1 chr3D.!!$R1 2585
6 TraesCS7D01G295200 chr4D 52459301 52461881 2580 False 4449 4449 97.759 1 2586 1 chr4D.!!$F1 2585

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
96 97 2.540383 AGGATCAGAACCAGCTGTACA 58.460 47.619 13.81 0.0 37.20 2.90 F
678 682 2.685897 GCTACACCCTGTTTTGTGACAA 59.314 45.455 0.00 0.0 36.35 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1418 1428 0.249741 CGTCGACCTTCCCACTTTGT 60.250 55.000 10.58 0.0 0.00 2.83 R
1604 1614 3.857052 CAGAATGTAAGGTAGGCGTTCA 58.143 45.455 0.00 0.0 32.34 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 97 2.540383 AGGATCAGAACCAGCTGTACA 58.460 47.619 13.81 0.00 37.20 2.90
456 457 9.223099 CTTCATCAACAAGCATATGGATATGTA 57.777 33.333 4.56 0.00 41.63 2.29
489 490 4.582869 ACAATCATGCAGTACACTGTGAT 58.417 39.130 15.86 9.70 45.45 3.06
678 682 2.685897 GCTACACCCTGTTTTGTGACAA 59.314 45.455 0.00 0.00 36.35 3.18
792 797 4.693566 GGAACTTTGTTCATACATGGACGA 59.306 41.667 11.75 0.00 39.20 4.20
932 937 5.123820 ACATGTCATTTTCCCAACTACATCG 59.876 40.000 0.00 0.00 0.00 3.84
1178 1186 2.711009 ACCTCAAAGAGACATGGAACCA 59.289 45.455 0.00 0.00 0.00 3.67
1262 1270 3.763057 AGCAAGGAAACCGGTATTTTCT 58.237 40.909 8.00 0.00 34.06 2.52
1604 1614 1.188219 ATCACGTGGTGCTCCTGACT 61.188 55.000 17.00 0.00 32.98 3.41
1724 1734 1.760613 GCCTAGTATACAGTGGTGGCA 59.239 52.381 5.50 0.00 38.99 4.92
1876 1886 2.306341 ATGCGTCCTTGATGTCTGAG 57.694 50.000 0.00 0.00 0.00 3.35
1934 1944 7.630924 AGTGAAAGTTATCGTTCTTTCTTGTG 58.369 34.615 15.33 0.00 45.36 3.33
2371 2381 6.544928 TTACTTCAGATTCTGATGCACCTA 57.455 37.500 22.74 10.04 40.39 3.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
43 44 2.705658 ACTTCCGGCTCATAATCATCCA 59.294 45.455 0.00 0.00 0.00 3.41
96 97 3.451141 TCCAAAGCGCTTGACAATTTT 57.549 38.095 25.80 1.36 37.17 1.82
456 457 2.824936 TGCATGATTGTTTTGTCGGGAT 59.175 40.909 0.00 0.00 0.00 3.85
489 490 3.446873 GTCACCATCCCATATTTTGCACA 59.553 43.478 0.00 0.00 0.00 4.57
638 642 1.602311 CCCACATCTGAAGCATAGCC 58.398 55.000 0.00 0.00 0.00 3.93
792 797 8.983702 TGTAGTGGGTAATTAAAAGAAGTTGT 57.016 30.769 0.00 0.00 0.00 3.32
932 937 6.597614 CAGAGCTCACATTAAGAACAGAAAC 58.402 40.000 17.77 0.00 0.00 2.78
1178 1186 6.542821 TGGACCTTTGAGTTTTCATAGTGAT 58.457 36.000 0.00 0.00 32.44 3.06
1262 1270 5.221904 TGGAGGACACATGAAGAAAAGATGA 60.222 40.000 0.00 0.00 0.00 2.92
1418 1428 0.249741 CGTCGACCTTCCCACTTTGT 60.250 55.000 10.58 0.00 0.00 2.83
1604 1614 3.857052 CAGAATGTAAGGTAGGCGTTCA 58.143 45.455 0.00 0.00 32.34 3.18
1876 1886 5.953183 TGATCAACTACATTTGCCATGTTC 58.047 37.500 4.09 0.00 33.76 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.