Multiple sequence alignment - TraesCS7D01G291000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G291000 chr7D 100.000 3048 0 0 1 3048 346629749 346626702 0 5629
1 TraesCS7D01G291000 chr7D 97.735 1766 38 2 1285 3048 608292144 608290379 0 3038
2 TraesCS7D01G291000 chr1D 97.716 3065 51 5 1 3048 42043959 42040897 0 5254
3 TraesCS7D01G291000 chr1D 96.834 1927 31 4 1152 3048 485426492 485424566 0 3193
4 TraesCS7D01G291000 chr1D 98.147 1727 31 1 1320 3045 162595774 162597500 0 3011
5 TraesCS7D01G291000 chr1D 97.964 1326 26 1 1 1326 162594414 162595738 0 2298
6 TraesCS7D01G291000 chr6D 95.781 3081 89 16 1 3048 360752998 360749926 0 4931
7 TraesCS7D01G291000 chr6D 95.501 2245 67 14 63 2281 360745659 360747895 0 3555
8 TraesCS7D01G291000 chr5A 96.984 1724 50 2 1327 3048 617310922 617309199 0 2894
9 TraesCS7D01G291000 chr2A 96.984 1724 50 2 1327 3048 171836712 171838435 0 2894
10 TraesCS7D01G291000 chr4B 96.810 1724 52 3 1327 3048 622886285 622884563 0 2876
11 TraesCS7D01G291000 chr4B 96.752 1724 54 2 1327 3048 445329352 445331075 0 2872
12 TraesCS7D01G291000 chr4B 97.442 1290 27 3 1 1285 622887578 622886290 0 2194
13 TraesCS7D01G291000 chr4B 97.209 1290 28 4 1 1285 445328061 445329347 0 2176
14 TraesCS7D01G291000 chr3B 97.674 1290 23 4 1 1285 777040436 777039149 0 2209
15 TraesCS7D01G291000 chr6A 97.364 1290 28 3 1 1285 46108946 46110234 0 2189
16 TraesCS7D01G291000 chr6A 97.287 1290 29 3 1 1285 46139863 46141151 0 2183


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G291000 chr7D 346626702 346629749 3047 True 5629.0 5629 100.0000 1 3048 1 chr7D.!!$R1 3047
1 TraesCS7D01G291000 chr7D 608290379 608292144 1765 True 3038.0 3038 97.7350 1285 3048 1 chr7D.!!$R2 1763
2 TraesCS7D01G291000 chr1D 42040897 42043959 3062 True 5254.0 5254 97.7160 1 3048 1 chr1D.!!$R1 3047
3 TraesCS7D01G291000 chr1D 485424566 485426492 1926 True 3193.0 3193 96.8340 1152 3048 1 chr1D.!!$R2 1896
4 TraesCS7D01G291000 chr1D 162594414 162597500 3086 False 2654.5 3011 98.0555 1 3045 2 chr1D.!!$F1 3044
5 TraesCS7D01G291000 chr6D 360749926 360752998 3072 True 4931.0 4931 95.7810 1 3048 1 chr6D.!!$R1 3047
6 TraesCS7D01G291000 chr6D 360745659 360747895 2236 False 3555.0 3555 95.5010 63 2281 1 chr6D.!!$F1 2218
7 TraesCS7D01G291000 chr5A 617309199 617310922 1723 True 2894.0 2894 96.9840 1327 3048 1 chr5A.!!$R1 1721
8 TraesCS7D01G291000 chr2A 171836712 171838435 1723 False 2894.0 2894 96.9840 1327 3048 1 chr2A.!!$F1 1721
9 TraesCS7D01G291000 chr4B 622884563 622887578 3015 True 2535.0 2876 97.1260 1 3048 2 chr4B.!!$R1 3047
10 TraesCS7D01G291000 chr4B 445328061 445331075 3014 False 2524.0 2872 96.9805 1 3048 2 chr4B.!!$F1 3047
11 TraesCS7D01G291000 chr3B 777039149 777040436 1287 True 2209.0 2209 97.6740 1 1285 1 chr3B.!!$R1 1284
12 TraesCS7D01G291000 chr6A 46108946 46110234 1288 False 2189.0 2189 97.3640 1 1285 1 chr6A.!!$F1 1284
13 TraesCS7D01G291000 chr6A 46139863 46141151 1288 False 2183.0 2183 97.2870 1 1285 1 chr6A.!!$F2 1284

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
833 841 1.526686 CCCGCTTGCATCATAGGCA 60.527 57.895 0.0 0.0 40.0 4.75 F
1821 1889 0.533308 GGTACAGACGTTGGTTGGCA 60.533 55.000 0.0 0.0 0.0 4.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1900 1968 2.224426 ACTGCAATGGAAGACCGTGTTA 60.224 45.455 0.00 0.0 39.42 2.41 R
2667 2739 8.154649 CATTGAGATGGGTATAACTTACCAAC 57.845 38.462 4.33 0.0 39.31 3.77 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
527 528 9.933723 TGAATATGACGATGATGATTACTGAAT 57.066 29.630 0.00 0.0 0.00 2.57
833 841 1.526686 CCCGCTTGCATCATAGGCA 60.527 57.895 0.00 0.0 40.00 4.75
855 863 2.766263 TGTCTCAATGGCTAGGTCGAAT 59.234 45.455 0.00 0.0 0.00 3.34
1062 1070 7.488187 AGCAATATTCATGTGCTAACTACAG 57.512 36.000 6.00 0.0 46.52 2.74
1577 1645 6.446909 ACATATTTTGGGATGGTTTTTGGT 57.553 33.333 0.00 0.0 0.00 3.67
1616 1684 0.539051 CCCATCGGAGCAAGAGAAGT 59.461 55.000 0.00 0.0 0.00 3.01
1760 1828 0.616395 TGAGGATGGTAACCGCTGGA 60.616 55.000 1.50 0.0 0.00 3.86
1821 1889 0.533308 GGTACAGACGTTGGTTGGCA 60.533 55.000 0.00 0.0 0.00 4.92
1900 1968 3.584848 AGAGGAACAGACTTGCTAATGGT 59.415 43.478 0.00 0.0 0.00 3.55
2096 2167 0.111061 TCTGGTGCTTGGCTTCACAT 59.889 50.000 6.66 0.0 35.04 3.21
2183 2254 8.410673 TGGGTCAGTAAAATATTGCAACTTAA 57.589 30.769 0.00 0.0 0.00 1.85
3035 3109 8.766994 AGAAATGCATGGTTAACTATATTGGT 57.233 30.769 0.00 0.0 0.00 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
833 841 2.388735 TCGACCTAGCCATTGAGACAT 58.611 47.619 0.00 0.0 0.00 3.06
855 863 3.633418 GGAGGCACTAGAAGAAGACCTA 58.367 50.000 0.00 0.0 41.55 3.08
1044 1052 7.334090 AGATCAACTGTAGTTAGCACATGAAT 58.666 34.615 0.00 0.0 36.32 2.57
1062 1070 9.683069 CATGCCCTGTTATAAATAAAGATCAAC 57.317 33.333 0.00 0.0 0.00 3.18
1577 1645 0.249531 TCGCACTTGAAACGCCACTA 60.250 50.000 0.00 0.0 0.00 2.74
1616 1684 2.978978 TCTCCTCCAAAACACCATCTGA 59.021 45.455 0.00 0.0 0.00 3.27
1760 1828 7.014230 TGCAGAAATTAAAGCTTCCTTAGTTGT 59.986 33.333 0.00 0.0 0.00 3.32
1821 1889 4.456535 ACTCGAGTGCTCACATAGTAGAT 58.543 43.478 19.30 0.0 0.00 1.98
1900 1968 2.224426 ACTGCAATGGAAGACCGTGTTA 60.224 45.455 0.00 0.0 39.42 2.41
2246 2318 5.125417 TGCCTTATCAAAATCCTCCTTTTCG 59.875 40.000 0.00 0.0 0.00 3.46
2564 2636 5.594317 AGCACAAACCTATTCACTCAAACTT 59.406 36.000 0.00 0.0 0.00 2.66
2667 2739 8.154649 CATTGAGATGGGTATAACTTACCAAC 57.845 38.462 4.33 0.0 39.31 3.77


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.