Multiple sequence alignment - TraesCS7D01G290400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G290400 chr7D 100.000 3419 0 0 1 3419 340297679 340301097 0.000000e+00 6314.0
1 TraesCS7D01G290400 chr7D 99.322 590 4 0 2830 3419 338132831 338132242 0.000000e+00 1068.0
2 TraesCS7D01G290400 chr7D 99.154 591 5 0 2829 3419 338125105 338124515 0.000000e+00 1064.0
3 TraesCS7D01G290400 chr7D 99.154 591 5 0 2829 3419 340310691 340311281 0.000000e+00 1064.0
4 TraesCS7D01G290400 chr7D 98.490 596 6 3 2825 3419 335996017 335995424 0.000000e+00 1048.0
5 TraesCS7D01G290400 chr7D 92.509 534 14 11 673 1203 340261030 340261540 0.000000e+00 741.0
6 TraesCS7D01G290400 chr7D 83.019 106 15 1 2345 2450 33101027 33101129 3.630000e-15 93.5
7 TraesCS7D01G290400 chr4D 96.674 2826 48 19 15 2827 417931931 417934723 0.000000e+00 4656.0
8 TraesCS7D01G290400 chr4D 98.459 714 10 1 1030 1743 417896576 417897288 0.000000e+00 1256.0
9 TraesCS7D01G290400 chr4D 87.931 116 13 1 2335 2449 18693547 18693432 5.950000e-28 135.0
10 TraesCS7D01G290400 chr4D 95.238 63 3 0 1141 1203 417897293 417897355 2.170000e-17 100.0
11 TraesCS7D01G290400 chr7B 96.091 2200 49 18 663 2834 469471028 469468838 0.000000e+00 3552.0
12 TraesCS7D01G290400 chr7B 92.626 556 31 7 1 553 469482343 469481795 0.000000e+00 791.0
13 TraesCS7D01G290400 chr7B 87.068 665 44 22 18 674 469474082 469473452 0.000000e+00 713.0
14 TraesCS7D01G290400 chr7B 81.009 674 76 24 1 667 537680980 537680352 3.970000e-134 488.0
15 TraesCS7D01G290400 chr7B 88.785 107 12 0 2343 2449 216938228 216938334 7.700000e-27 132.0
16 TraesCS7D01G290400 chr4B 81.739 1380 198 35 925 2268 86362981 86364342 0.000000e+00 1103.0
17 TraesCS7D01G290400 chr4B 88.136 118 9 4 2335 2449 30729293 30729178 5.950000e-28 135.0
18 TraesCS7D01G290400 chrUn 99.154 591 5 0 2829 3419 449707540 449706950 0.000000e+00 1064.0
19 TraesCS7D01G290400 chrUn 97.869 610 8 4 2814 3419 106630500 106629892 0.000000e+00 1050.0
20 TraesCS7D01G290400 chr2D 99.153 590 4 1 2830 3419 268684294 268683706 0.000000e+00 1061.0
21 TraesCS7D01G290400 chr2D 87.542 594 61 10 1 592 369700600 369700018 0.000000e+00 675.0
22 TraesCS7D01G290400 chr2D 79.087 263 40 14 359 616 202071997 202072249 2.110000e-37 167.0
23 TraesCS7D01G290400 chr2D 86.957 92 8 4 2359 2448 480566592 480566681 2.170000e-17 100.0
24 TraesCS7D01G290400 chr6D 98.662 598 6 2 2824 3419 215015033 215014436 0.000000e+00 1059.0
25 TraesCS7D01G290400 chr5D 98.662 598 6 2 2824 3419 187225477 187224880 0.000000e+00 1059.0
26 TraesCS7D01G290400 chr5D 85.636 550 47 14 1 530 227402254 227401717 1.790000e-152 549.0
27 TraesCS7D01G290400 chr5D 86.327 373 36 11 301 665 488220923 488220558 3.200000e-105 392.0
28 TraesCS7D01G290400 chr4A 80.847 1086 172 19 1212 2274 538895914 538894842 0.000000e+00 821.0
29 TraesCS7D01G290400 chr3D 85.015 674 74 21 5 660 374275918 374275254 0.000000e+00 660.0
30 TraesCS7D01G290400 chr3D 84.326 638 66 19 55 665 544777476 544778106 8.170000e-166 593.0
31 TraesCS7D01G290400 chr1B 82.116 671 85 26 3 660 547407631 547406983 3.000000e-150 542.0
32 TraesCS7D01G290400 chr1A 83.472 599 60 21 2 597 148951737 148951175 3.910000e-144 521.0
33 TraesCS7D01G290400 chr5B 82.063 669 57 21 1 660 393834188 393833574 2.350000e-141 512.0
34 TraesCS7D01G290400 chr5A 89.720 107 11 0 2342 2448 559809633 559809527 1.650000e-28 137.0
35 TraesCS7D01G290400 chr7A 86.170 94 10 3 2359 2450 339753176 339753268 7.810000e-17 99.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G290400 chr7D 340297679 340301097 3418 False 6314.0 6314 100.0000 1 3419 1 chr7D.!!$F3 3418
1 TraesCS7D01G290400 chr7D 338132242 338132831 589 True 1068.0 1068 99.3220 2830 3419 1 chr7D.!!$R3 589
2 TraesCS7D01G290400 chr7D 338124515 338125105 590 True 1064.0 1064 99.1540 2829 3419 1 chr7D.!!$R2 590
3 TraesCS7D01G290400 chr7D 340310691 340311281 590 False 1064.0 1064 99.1540 2829 3419 1 chr7D.!!$F4 590
4 TraesCS7D01G290400 chr7D 335995424 335996017 593 True 1048.0 1048 98.4900 2825 3419 1 chr7D.!!$R1 594
5 TraesCS7D01G290400 chr7D 340261030 340261540 510 False 741.0 741 92.5090 673 1203 1 chr7D.!!$F2 530
6 TraesCS7D01G290400 chr4D 417931931 417934723 2792 False 4656.0 4656 96.6740 15 2827 1 chr4D.!!$F1 2812
7 TraesCS7D01G290400 chr4D 417896576 417897355 779 False 678.0 1256 96.8485 1030 1743 2 chr4D.!!$F2 713
8 TraesCS7D01G290400 chr7B 469468838 469474082 5244 True 2132.5 3552 91.5795 18 2834 2 chr7B.!!$R3 2816
9 TraesCS7D01G290400 chr7B 469481795 469482343 548 True 791.0 791 92.6260 1 553 1 chr7B.!!$R1 552
10 TraesCS7D01G290400 chr7B 537680352 537680980 628 True 488.0 488 81.0090 1 667 1 chr7B.!!$R2 666
11 TraesCS7D01G290400 chr4B 86362981 86364342 1361 False 1103.0 1103 81.7390 925 2268 1 chr4B.!!$F1 1343
12 TraesCS7D01G290400 chrUn 449706950 449707540 590 True 1064.0 1064 99.1540 2829 3419 1 chrUn.!!$R2 590
13 TraesCS7D01G290400 chrUn 106629892 106630500 608 True 1050.0 1050 97.8690 2814 3419 1 chrUn.!!$R1 605
14 TraesCS7D01G290400 chr2D 268683706 268684294 588 True 1061.0 1061 99.1530 2830 3419 1 chr2D.!!$R1 589
15 TraesCS7D01G290400 chr2D 369700018 369700600 582 True 675.0 675 87.5420 1 592 1 chr2D.!!$R2 591
16 TraesCS7D01G290400 chr6D 215014436 215015033 597 True 1059.0 1059 98.6620 2824 3419 1 chr6D.!!$R1 595
17 TraesCS7D01G290400 chr5D 187224880 187225477 597 True 1059.0 1059 98.6620 2824 3419 1 chr5D.!!$R1 595
18 TraesCS7D01G290400 chr5D 227401717 227402254 537 True 549.0 549 85.6360 1 530 1 chr5D.!!$R2 529
19 TraesCS7D01G290400 chr4A 538894842 538895914 1072 True 821.0 821 80.8470 1212 2274 1 chr4A.!!$R1 1062
20 TraesCS7D01G290400 chr3D 374275254 374275918 664 True 660.0 660 85.0150 5 660 1 chr3D.!!$R1 655
21 TraesCS7D01G290400 chr3D 544777476 544778106 630 False 593.0 593 84.3260 55 665 1 chr3D.!!$F1 610
22 TraesCS7D01G290400 chr1B 547406983 547407631 648 True 542.0 542 82.1160 3 660 1 chr1B.!!$R1 657
23 TraesCS7D01G290400 chr1A 148951175 148951737 562 True 521.0 521 83.4720 2 597 1 chr1A.!!$R1 595
24 TraesCS7D01G290400 chr5B 393833574 393834188 614 True 512.0 512 82.0630 1 660 1 chr5B.!!$R1 659

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
941 3464 0.107017 CTCCAATTGATCTGGCCGGT 60.107 55.0 12.43 0.0 33.63 5.28 F
1457 3998 1.075542 CGCTTGGTCAACGAATGCTA 58.924 50.0 0.00 0.0 0.00 3.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2130 4701 0.180406 ACCAAACTTCACTGTCCGCT 59.820 50.000 0.0 0.00 0.0 5.52 R
2649 5228 1.065701 GTACTGGCACGAGTCGATCAT 59.934 52.381 21.5 1.89 0.0 2.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
363 414 9.284594 TGAACGTTTTCTAAAATTCTTGAACAG 57.715 29.630 0.46 0.00 32.36 3.16
941 3464 0.107017 CTCCAATTGATCTGGCCGGT 60.107 55.000 12.43 0.00 33.63 5.28
1457 3998 1.075542 CGCTTGGTCAACGAATGCTA 58.924 50.000 0.00 0.00 0.00 3.49
1534 4087 2.836981 CAGGAGAATGGAGAGTTCCTGT 59.163 50.000 10.00 0.00 46.24 4.00
1781 4340 2.046023 CTGCCGGCCAGACATGAA 60.046 61.111 26.77 0.00 44.64 2.57
1782 4341 2.359850 TGCCGGCCAGACATGAAC 60.360 61.111 26.77 0.00 0.00 3.18
1783 4342 2.045926 GCCGGCCAGACATGAACT 60.046 61.111 18.11 0.00 0.00 3.01
1826 4388 3.597550 TCGCCTTCGACATGTCAAA 57.402 47.368 24.93 12.86 40.21 2.69
2130 4701 5.080337 TGTTTCTTGGCCAAACACCATATA 58.920 37.500 20.91 0.00 38.53 0.86
2433 5008 5.232463 TCCGTTTAAGCGTCAAGTAATTCT 58.768 37.500 10.88 0.00 0.00 2.40
2649 5228 6.367149 GCGATGAGAACATGAAGCATCTATTA 59.633 38.462 0.00 0.00 36.82 0.98
2684 5263 6.201044 CGTGCCAGTACAAGATAATAAAGGAG 59.799 42.308 0.00 0.00 0.00 3.69
2778 5373 2.181975 CAGGTGAAAAGGAATGCCCAT 58.818 47.619 0.00 0.00 37.41 4.00
2779 5374 2.093869 CAGGTGAAAAGGAATGCCCATG 60.094 50.000 0.00 0.00 37.41 3.66
2960 5561 9.508567 GTTTCTTGCTAATGATTCTAATGTTCC 57.491 33.333 0.00 0.00 0.00 3.62
3092 5693 1.212751 GCATGGGGAACAAGAACGC 59.787 57.895 0.00 0.00 0.00 4.84
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
126 133 5.841957 AAGATAATGTCCATGGCTCAAAC 57.158 39.130 6.96 0.00 0.00 2.93
284 334 6.680338 CGAAAATGTTCACGAATTTGCAAAAA 59.320 30.769 17.19 1.47 32.89 1.94
285 335 6.181255 CGAAAATGTTCACGAATTTGCAAAA 58.819 32.000 17.19 0.00 32.89 2.44
286 336 5.722237 CGAAAATGTTCACGAATTTGCAAA 58.278 33.333 15.44 15.44 32.89 3.68
287 337 4.317698 GCGAAAATGTTCACGAATTTGCAA 60.318 37.500 0.00 0.00 32.89 4.08
542 607 7.899178 ATTTGTTTTTCGTCTTTTCCTTTGT 57.101 28.000 0.00 0.00 0.00 2.83
941 3464 1.405463 CTCGGATGGATCTTGACGACA 59.595 52.381 0.00 0.00 0.00 4.35
1265 3806 0.681564 GAGAGGCTCCTCGGTGAAGA 60.682 60.000 11.71 0.00 46.90 2.87
1457 3998 4.344865 AAACGAGGCCCACCGCAT 62.345 61.111 0.00 0.00 42.76 4.73
1534 4087 3.378742 GTCTCGGAGCTGAAGATGTAGAA 59.621 47.826 0.00 0.00 0.00 2.10
1727 4286 3.017442 AGACGTAGATAGCACAGCTCAA 58.983 45.455 0.00 0.00 40.44 3.02
1781 4340 3.921257 GGTTGCAACCGGTAGTAGT 57.079 52.632 31.73 0.00 39.66 2.73
1824 4386 2.095768 CCTGATGCGAATTGTGTCGTTT 60.096 45.455 0.00 0.00 43.06 3.60
1826 4388 1.078709 CCTGATGCGAATTGTGTCGT 58.921 50.000 0.00 0.00 43.06 4.34
1962 4527 5.866159 AGAGTTCATGATCATAGAGCACA 57.134 39.130 8.15 0.00 28.34 4.57
2130 4701 0.180406 ACCAAACTTCACTGTCCGCT 59.820 50.000 0.00 0.00 0.00 5.52
2433 5008 1.304713 GGTGTACTCCCTCCGTCCA 60.305 63.158 2.33 0.00 0.00 4.02
2649 5228 1.065701 GTACTGGCACGAGTCGATCAT 59.934 52.381 21.50 1.89 0.00 2.45
2783 5378 2.254152 ATGACTCTAGCTGGGTTCCA 57.746 50.000 0.00 0.00 0.00 3.53
2960 5561 8.944029 CCAATTTAGGTAGCATCATATTCTCAG 58.056 37.037 0.00 0.00 0.00 3.35
3092 5693 6.401474 CGTCCTGAAATCATCACTTGTAACTG 60.401 42.308 0.00 0.00 33.47 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.