Multiple sequence alignment - TraesCS7D01G286300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G286300 chr7D 100.000 2192 0 0 1 2192 307146623 307144432 0 4048
1 TraesCS7D01G286300 chr4D 97.727 2200 42 3 1 2192 123448986 123446787 0 3779
2 TraesCS7D01G286300 chr3A 97.767 2194 47 2 1 2192 495104760 495102567 0 3779
3 TraesCS7D01G286300 chr2B 97.767 2194 47 2 1 2192 234541160 234538967 0 3779
4 TraesCS7D01G286300 chr3B 97.678 2196 44 5 1 2192 92296732 92294540 0 3766
5 TraesCS7D01G286300 chr3B 97.539 2194 51 3 1 2192 6010766 6008574 0 3749
6 TraesCS7D01G286300 chr1A 97.675 2194 48 3 1 2192 278521194 278523386 0 3766
7 TraesCS7D01G286300 chrUn 97.539 2194 51 3 1 2192 217907668 217909860 0 3749
8 TraesCS7D01G286300 chr1B 97.402 2194 54 3 1 2192 619195331 619193139 0 3733
9 TraesCS7D01G286300 chr4A 97.265 2194 58 2 1 2192 67519498 67521691 0 3718


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G286300 chr7D 307144432 307146623 2191 True 4048 4048 100.000 1 2192 1 chr7D.!!$R1 2191
1 TraesCS7D01G286300 chr4D 123446787 123448986 2199 True 3779 3779 97.727 1 2192 1 chr4D.!!$R1 2191
2 TraesCS7D01G286300 chr3A 495102567 495104760 2193 True 3779 3779 97.767 1 2192 1 chr3A.!!$R1 2191
3 TraesCS7D01G286300 chr2B 234538967 234541160 2193 True 3779 3779 97.767 1 2192 1 chr2B.!!$R1 2191
4 TraesCS7D01G286300 chr3B 92294540 92296732 2192 True 3766 3766 97.678 1 2192 1 chr3B.!!$R2 2191
5 TraesCS7D01G286300 chr3B 6008574 6010766 2192 True 3749 3749 97.539 1 2192 1 chr3B.!!$R1 2191
6 TraesCS7D01G286300 chr1A 278521194 278523386 2192 False 3766 3766 97.675 1 2192 1 chr1A.!!$F1 2191
7 TraesCS7D01G286300 chrUn 217907668 217909860 2192 False 3749 3749 97.539 1 2192 1 chrUn.!!$F1 2191
8 TraesCS7D01G286300 chr1B 619193139 619195331 2192 True 3733 3733 97.402 1 2192 1 chr1B.!!$R1 2191
9 TraesCS7D01G286300 chr4A 67519498 67521691 2193 False 3718 3718 97.265 1 2192 1 chr4A.!!$F1 2191

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
904 907 0.320334 TCAGCTCGCCAAATTCGTCA 60.32 50.0 0.0 0.0 0.0 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1737 1746 1.342374 GGGTTCCCAATGCTTCTCCAT 60.342 52.381 2.59 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 75 2.267174 ACTCATGCTATGGATGTGGC 57.733 50.000 6.20 0.00 0.00 5.01
164 165 1.755395 GAGCCAGGATGCATGCCAA 60.755 57.895 16.68 0.00 31.97 4.52
196 197 1.278985 CTGGTGGAGTGGCACAAGATA 59.721 52.381 21.41 0.43 44.16 1.98
198 199 3.111484 TGGTGGAGTGGCACAAGATATA 58.889 45.455 21.41 0.00 44.16 0.86
256 257 5.238432 ACACAACAATTTGCTTCTCGTATCA 59.762 36.000 0.00 0.00 36.00 2.15
380 381 4.039488 TGGTGTAATGTTAAGAGGTCGTGT 59.961 41.667 0.00 0.00 0.00 4.49
402 403 6.037940 GTGTGACATGAAGACATTGATAGCAT 59.962 38.462 0.00 0.00 34.15 3.79
404 405 7.121611 TGTGACATGAAGACATTGATAGCATTT 59.878 33.333 0.00 0.00 34.15 2.32
606 609 2.361104 GCGGGCCATCAACCTTCA 60.361 61.111 4.39 0.00 0.00 3.02
772 775 3.632643 TCTCCATATGAAAGTGCTGCA 57.367 42.857 3.65 0.00 0.00 4.41
904 907 0.320334 TCAGCTCGCCAAATTCGTCA 60.320 50.000 0.00 0.00 0.00 4.35
1160 1163 6.611642 ACTCTATTGGTCATAGTTCCTTGCTA 59.388 38.462 0.00 0.00 36.87 3.49
1323 1332 3.260100 CCCCCACTGACTTGGCCT 61.260 66.667 3.32 0.00 35.00 5.19
1595 1604 3.006323 GCTATGTCCTCCATCACGATCTT 59.994 47.826 0.00 0.00 34.86 2.40
1797 1806 1.497716 AGTTTCTTTTCCCGTCCCCTT 59.502 47.619 0.00 0.00 0.00 3.95
1879 1889 1.279025 TTGATCCGGGGGAAAGGGAG 61.279 60.000 0.00 0.00 34.34 4.30
1931 1941 3.461085 AGGTTGTGGCTTGATGAGGATAT 59.539 43.478 0.00 0.00 0.00 1.63
2131 2141 3.013921 GCCATCTTATCCACGGAAAACA 58.986 45.455 0.00 0.00 0.00 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
164 165 2.838202 ACTCCACCAGGTCGTATGAAAT 59.162 45.455 0.00 0.0 35.89 2.17
196 197 4.215908 TCTCGACATAAGCCAAGAGGTAT 58.784 43.478 0.00 0.0 37.19 2.73
198 199 2.457598 TCTCGACATAAGCCAAGAGGT 58.542 47.619 0.00 0.0 37.19 3.85
256 257 7.012421 GCCGGTTTACATCTCTTCTAATTCATT 59.988 37.037 1.90 0.0 0.00 2.57
275 276 1.283613 TCCAGATATGGTTGCCGGTTT 59.716 47.619 6.21 0.0 0.00 3.27
380 381 7.634671 AAATGCTATCAATGTCTTCATGTCA 57.365 32.000 0.00 0.0 34.19 3.58
904 907 4.929707 GGGGCGCCCGATTCGATT 62.930 66.667 38.22 0.0 36.85 3.34
1323 1332 0.476338 TGCACTTTCACTTAGGCCCA 59.524 50.000 0.00 0.0 0.00 5.36
1595 1604 6.260714 CACGATTCCATGGATAGTTTCATTCA 59.739 38.462 17.06 0.0 0.00 2.57
1737 1746 1.342374 GGGTTCCCAATGCTTCTCCAT 60.342 52.381 2.59 0.0 0.00 3.41
1879 1889 2.019156 GCTTCCCAACTGGTAGATGGC 61.019 57.143 0.05 0.0 36.89 4.40
1882 1892 3.707102 GTCTAGCTTCCCAACTGGTAGAT 59.293 47.826 0.00 0.0 41.03 1.98
1931 1941 1.934220 CTCCGGCGTGTCAGCTTAGA 61.934 60.000 6.01 0.0 37.29 2.10
2150 2160 4.510340 GTCCTTTTCTTTAGTGCTTCGACA 59.490 41.667 0.00 0.0 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.