Multiple sequence alignment - TraesCS7D01G285700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G285700 chr7D 100.000 2359 0 0 1 2359 307045638 307047996 0.000000e+00 4357
1 TraesCS7D01G285700 chr5D 97.514 2373 42 9 3 2359 503225683 503223312 0.000000e+00 4039
2 TraesCS7D01G285700 chr5D 97.053 2375 51 10 3 2359 503235999 503233626 0.000000e+00 3980
3 TraesCS7D01G285700 chr5D 96.669 2372 62 8 3 2359 6196401 6194032 0.000000e+00 3927
4 TraesCS7D01G285700 chr5D 97.133 1988 41 8 3 1974 503270862 503272849 0.000000e+00 3341
5 TraesCS7D01G285700 chr5D 96.278 994 23 6 3 982 503240249 503239256 0.000000e+00 1618
6 TraesCS7D01G285700 chr1A 97.261 2373 49 10 3 2359 278526775 278529147 0.000000e+00 4008
7 TraesCS7D01G285700 chr3A 97.219 2373 49 9 3 2359 66010158 66012529 0.000000e+00 4000
8 TraesCS7D01G285700 chr2B 97.177 2373 51 8 3 2359 449213751 449211379 0.000000e+00 3997
9 TraesCS7D01G285700 chr2B 97.173 2370 54 5 3 2359 474915905 474913536 0.000000e+00 3993
10 TraesCS7D01G285700 chr6D 97.049 2372 55 7 3 2359 458922779 458920408 0.000000e+00 3978
11 TraesCS7D01G285700 chr6D 96.415 1590 42 9 1 1576 108490769 108492357 0.000000e+00 2606
12 TraesCS7D01G285700 chr6D 96.378 994 22 7 3 982 389252142 389251149 0.000000e+00 1624
13 TraesCS7D01G285700 chr1D 96.971 2377 54 7 1 2359 254387620 254389996 0.000000e+00 3975
14 TraesCS7D01G285700 chr7B 94.770 2371 109 8 3 2359 105232733 105235102 0.000000e+00 3677
15 TraesCS7D01G285700 chr3D 96.799 1312 27 7 3 1301 589268454 589269763 0.000000e+00 2176
16 TraesCS7D01G285700 chr5B 94.842 349 9 3 3 342 38121514 38121166 9.590000e-149 536


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G285700 chr7D 307045638 307047996 2358 False 4357 4357 100.0000 1 2359 1 chr7D.!!$F1 2358
1 TraesCS7D01G285700 chr5D 503223312 503225683 2371 True 4039 4039 97.5140 3 2359 1 chr5D.!!$R2 2356
2 TraesCS7D01G285700 chr5D 6194032 6196401 2369 True 3927 3927 96.6690 3 2359 1 chr5D.!!$R1 2356
3 TraesCS7D01G285700 chr5D 503270862 503272849 1987 False 3341 3341 97.1330 3 1974 1 chr5D.!!$F1 1971
4 TraesCS7D01G285700 chr5D 503233626 503240249 6623 True 2799 3980 96.6655 3 2359 2 chr5D.!!$R3 2356
5 TraesCS7D01G285700 chr1A 278526775 278529147 2372 False 4008 4008 97.2610 3 2359 1 chr1A.!!$F1 2356
6 TraesCS7D01G285700 chr3A 66010158 66012529 2371 False 4000 4000 97.2190 3 2359 1 chr3A.!!$F1 2356
7 TraesCS7D01G285700 chr2B 449211379 449213751 2372 True 3997 3997 97.1770 3 2359 1 chr2B.!!$R1 2356
8 TraesCS7D01G285700 chr2B 474913536 474915905 2369 True 3993 3993 97.1730 3 2359 1 chr2B.!!$R2 2356
9 TraesCS7D01G285700 chr6D 458920408 458922779 2371 True 3978 3978 97.0490 3 2359 1 chr6D.!!$R2 2356
10 TraesCS7D01G285700 chr6D 108490769 108492357 1588 False 2606 2606 96.4150 1 1576 1 chr6D.!!$F1 1575
11 TraesCS7D01G285700 chr6D 389251149 389252142 993 True 1624 1624 96.3780 3 982 1 chr6D.!!$R1 979
12 TraesCS7D01G285700 chr1D 254387620 254389996 2376 False 3975 3975 96.9710 1 2359 1 chr1D.!!$F1 2358
13 TraesCS7D01G285700 chr7B 105232733 105235102 2369 False 3677 3677 94.7700 3 2359 1 chr7B.!!$F1 2356
14 TraesCS7D01G285700 chr3D 589268454 589269763 1309 False 2176 2176 96.7990 3 1301 1 chr3D.!!$F1 1298

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
590 4852 1.602377 CGGGTCGAAATATGGCTTTCC 59.398 52.381 0.0 0.0 32.6 3.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1546 5813 0.039035 TGCCCCACCCATGAGTAAAC 59.961 55.0 0.0 0.0 0.0 2.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
160 162 4.833380 CCTATCTTTCGAGATCCACCCTAA 59.167 45.833 0.00 0.00 0.00 2.69
227 230 9.774742 CCTATAAAAAGAAAACGGATTCTTGAG 57.225 33.333 15.61 9.62 46.25 3.02
290 300 5.545588 TGCAAAATCCGATCCAATTTTTCA 58.454 33.333 9.04 8.39 33.86 2.69
333 343 7.614124 GGTGGTTAACCGTATTATGAAAGAA 57.386 36.000 19.65 0.00 39.81 2.52
370 381 7.290110 TGGCTTATCAAATTCTCTATCGAGA 57.710 36.000 0.00 0.00 44.32 4.04
590 4852 1.602377 CGGGTCGAAATATGGCTTTCC 59.398 52.381 0.00 0.00 32.60 3.13
739 5001 8.580720 AGAATCTATGTATGTAGACACATGGAC 58.419 37.037 0.00 0.00 45.17 4.02
992 5257 5.473504 ACTTTTCGTAGATTGGATGCAGTTT 59.526 36.000 0.00 0.00 35.04 2.66
1154 5419 5.982356 TCTTCTGATGATCGATTCAACCTT 58.018 37.500 0.00 0.00 38.03 3.50
1546 5813 6.587990 CGGTCTAATGAGGCTACTATGAAATG 59.412 42.308 0.00 0.00 0.00 2.32
1618 5885 2.912956 GGCTATATGGTTCATCTGGGGA 59.087 50.000 0.00 0.00 0.00 4.81
1625 5896 2.293118 TGGTTCATCTGGGGAGAGATCA 60.293 50.000 0.00 0.00 29.72 2.92
1661 5932 7.915293 ATTGTGAACGGTCTTATCAATACAA 57.085 32.000 0.33 1.24 0.00 2.41
1863 6134 6.053632 TCCATAGACATGCAGAAGAGAAAA 57.946 37.500 0.00 0.00 0.00 2.29
1887 6158 1.221840 CCCCACTCCGACCAAGATG 59.778 63.158 0.00 0.00 0.00 2.90
1976 6247 9.334947 TCAGGAACAATGAATCTCTTTATGATC 57.665 33.333 0.00 0.00 0.00 2.92
2281 6552 4.202609 ACAACCACTGATGAAGGATTCCTT 60.203 41.667 17.98 17.98 46.93 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
4 5 3.197116 TGAGTATCCGTTTCCCTCCTTTC 59.803 47.826 0.00 0.00 0.00 2.62
43 44 7.384477 TCTATGAGATCGAGTACGGAATTCTA 58.616 38.462 5.23 0.00 40.21 2.10
160 162 5.574970 TTTGGCTTTTTGACCCCATATTT 57.425 34.783 0.00 0.00 0.00 1.40
202 205 9.278734 GCTCAAGAATCCGTTTTCTTTTTATAG 57.721 33.333 7.00 3.30 41.95 1.31
227 230 2.853914 GACGTGCGTGAAAGAGGC 59.146 61.111 0.67 0.00 35.92 4.70
290 300 8.974060 AACCACCATGTTAACTAATCGATTAT 57.026 30.769 17.84 7.35 0.00 1.28
370 381 7.087639 TGTCTTTTGTTGAATCTTTTTCACGT 58.912 30.769 0.00 0.00 0.00 4.49
739 5001 0.949397 TTCCGATCGAGATGTACGGG 59.051 55.000 18.66 0.00 43.14 5.28
976 5241 8.843262 CATGAATTAGAAACTGCATCCAATCTA 58.157 33.333 0.00 0.00 0.00 1.98
992 5257 6.829849 TGTACATGCCAGATCATGAATTAGA 58.170 36.000 0.00 0.00 44.94 2.10
1154 5419 7.944554 AGAACCAAGGTCTATCTTTTTGATCAA 59.055 33.333 3.38 3.38 36.65 2.57
1546 5813 0.039035 TGCCCCACCCATGAGTAAAC 59.961 55.000 0.00 0.00 0.00 2.01
1618 5885 6.713903 TCACAATTTCTTGAAGCTTGATCTCT 59.286 34.615 2.10 0.00 36.20 3.10
1625 5896 4.097892 ACCGTTCACAATTTCTTGAAGCTT 59.902 37.500 0.00 0.00 36.20 3.74
1661 5932 7.898636 TGAAATTCCTGGGGAGTTATACATTTT 59.101 33.333 0.00 0.00 30.35 1.82
1863 6134 1.457831 GGTCGGAGTGGGGATAGCT 60.458 63.158 0.00 0.00 0.00 3.32
1920 6191 7.870445 TGCTTCACCTTAATTGTTATTTGAACC 59.130 33.333 0.00 0.00 0.00 3.62
1976 6247 4.383649 CGAACTTGCAAAATGGATCTGTTG 59.616 41.667 0.00 0.00 0.00 3.33
2331 6602 4.620184 GCGTATGTATAAGACCGAATCCAC 59.380 45.833 0.00 0.00 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.