Multiple sequence alignment - TraesCS7D01G285500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G285500 chr7D 100.000 2341 0 0 1 2341 307034495 307032155 0 4324
1 TraesCS7D01G285500 chr7D 98.208 2344 39 3 1 2341 382087952 382090295 0 4093
2 TraesCS7D01G285500 chr7D 97.997 2347 38 5 1 2341 626713042 626710699 0 4065
3 TraesCS7D01G285500 chr7A 98.298 2350 30 5 1 2341 638509517 638507169 0 4109
4 TraesCS7D01G285500 chrUn 97.872 2350 41 5 1 2341 171006434 171008783 0 4054
5 TraesCS7D01G285500 chr6B 97.830 2350 42 5 1 2341 596603711 596601362 0 4048
6 TraesCS7D01G285500 chr1B 97.530 2348 50 5 1 2341 672539372 672541718 0 4008
7 TraesCS7D01G285500 chr2B 97.066 2352 58 5 1 2341 391227096 391224745 0 3951
8 TraesCS7D01G285500 chr3B 95.956 2349 83 7 1 2341 39875226 39877570 0 3801
9 TraesCS7D01G285500 chr4A 95.945 2343 88 6 1 2341 350237935 350240272 0 3794


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G285500 chr7D 307032155 307034495 2340 True 4324 4324 100.000 1 2341 1 chr7D.!!$R1 2340
1 TraesCS7D01G285500 chr7D 382087952 382090295 2343 False 4093 4093 98.208 1 2341 1 chr7D.!!$F1 2340
2 TraesCS7D01G285500 chr7D 626710699 626713042 2343 True 4065 4065 97.997 1 2341 1 chr7D.!!$R2 2340
3 TraesCS7D01G285500 chr7A 638507169 638509517 2348 True 4109 4109 98.298 1 2341 1 chr7A.!!$R1 2340
4 TraesCS7D01G285500 chrUn 171006434 171008783 2349 False 4054 4054 97.872 1 2341 1 chrUn.!!$F1 2340
5 TraesCS7D01G285500 chr6B 596601362 596603711 2349 True 4048 4048 97.830 1 2341 1 chr6B.!!$R1 2340
6 TraesCS7D01G285500 chr1B 672539372 672541718 2346 False 4008 4008 97.530 1 2341 1 chr1B.!!$F1 2340
7 TraesCS7D01G285500 chr2B 391224745 391227096 2351 True 3951 3951 97.066 1 2341 1 chr2B.!!$R1 2340
8 TraesCS7D01G285500 chr3B 39875226 39877570 2344 False 3801 3801 95.956 1 2341 1 chr3B.!!$F1 2340
9 TraesCS7D01G285500 chr4A 350237935 350240272 2337 False 3794 3794 95.945 1 2341 1 chr4A.!!$F1 2340

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
762 769 1.816863 GCTCCGTGAGAAGGTGGACA 61.817 60.0 5.24 0.0 0.0 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1664 1679 1.078143 ATCAGAGGTTCGGCTTGCC 60.078 57.895 0.75 0.75 0.0 4.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
265 271 6.920569 TGAAGTTCTACTTTGTCTTTGGAC 57.079 37.500 4.17 0.0 38.80 4.02
373 380 4.388499 GCGTTCGGGGCTTCTCCA 62.388 66.667 0.00 0.0 36.21 3.86
457 464 4.563580 GGACTGCTTTTGTCTCTGGATGTA 60.564 45.833 0.00 0.0 35.04 2.29
762 769 1.816863 GCTCCGTGAGAAGGTGGACA 61.817 60.000 5.24 0.0 0.00 4.02
867 877 2.342650 GCGGGGCTTTGCATCTGAA 61.343 57.895 0.00 0.0 0.00 3.02
995 1005 2.434702 GGGTAGCCTAGTGTGTAAGCAT 59.565 50.000 2.95 0.0 0.00 3.79
1084 1094 1.421646 ACCCTTTGACTCTTCCACTGG 59.578 52.381 0.00 0.0 0.00 4.00
1705 1720 3.437395 CGACCCGGACACATCAAAAATTA 59.563 43.478 0.73 0.0 0.00 1.40
1838 1853 6.257849 GGTTGTAATAGATCGACTTGAATGCA 59.742 38.462 0.00 0.0 0.00 3.96
1927 1942 0.905357 GAGCCCTGCTTTGGTCTCTA 59.095 55.000 0.00 0.0 39.88 2.43
2045 2061 3.215151 TCGACTTCTCCGCTATGATCTT 58.785 45.455 0.00 0.0 0.00 2.40
2140 2156 5.103000 CGGAGATTCACGAAGAAGTATTGT 58.897 41.667 0.00 0.0 40.15 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
67 68 1.072965 CTCCAGACCTTTGAAGTGCCT 59.927 52.381 0.00 0.00 0.00 4.75
130 131 2.930109 TCTGGAGCTAAGGAAGGACT 57.070 50.000 0.00 0.00 0.00 3.85
265 271 3.786635 AGAGTCCGATTCTTCCAATTCG 58.213 45.455 0.00 0.00 0.00 3.34
373 380 0.798776 CTGCTTTCGCGGTCTCAAAT 59.201 50.000 6.13 0.00 39.65 2.32
762 769 3.181434 TGAGGTACAACAAGGCCATTTCT 60.181 43.478 5.01 0.00 0.00 2.52
816 826 6.297080 AGATCATATTGGCATACTCTCCTG 57.703 41.667 0.00 0.00 0.00 3.86
867 877 2.162681 CAGAGGAAAGCCCAACGAATT 58.837 47.619 0.00 0.00 37.41 2.17
995 1005 3.192230 CGCCGCGGTTCATTGCTA 61.192 61.111 28.70 0.00 0.00 3.49
1084 1094 8.969267 GTATGAGCATTCGGTACATATATAAGC 58.031 37.037 0.00 0.00 0.00 3.09
1209 1220 3.981211 TCTTGTAACCGTCACCTGTAAC 58.019 45.455 0.00 0.00 0.00 2.50
1398 1409 0.933796 GCAATAGCAGCTCCGAGAAC 59.066 55.000 0.00 0.00 41.58 3.01
1568 1582 1.271054 CGGAATAGGAGGAAGCCATGG 60.271 57.143 7.63 7.63 0.00 3.66
1664 1679 1.078143 ATCAGAGGTTCGGCTTGCC 60.078 57.895 0.75 0.75 0.00 4.52
1927 1942 2.846193 AGCACGTACAACCATCAAACT 58.154 42.857 0.00 0.00 0.00 2.66
2045 2061 5.340891 AGCTCCTATATGAACTACTGGGA 57.659 43.478 0.00 0.00 0.00 4.37


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.