Multiple sequence alignment - TraesCS7D01G285400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G285400 chr7D 100.000 2285 0 0 1 2285 307033607 307031323 0.000000e+00 4220
1 TraesCS7D01G285400 chr7D 97.244 2286 56 5 1 2285 307161963 307164242 0.000000e+00 3866
2 TraesCS7D01G285400 chr7D 97.624 2104 40 8 1 2096 382088841 382090942 0.000000e+00 3600
3 TraesCS7D01G285400 chr7D 97.340 2105 45 9 1 2096 626712154 626710052 0.000000e+00 3567
4 TraesCS7D01G285400 chr1D 97.684 2288 46 5 1 2285 275787544 275785261 0.000000e+00 3925
5 TraesCS7D01G285400 chr4D 97.055 2105 47 11 2 2096 123400560 123402659 0.000000e+00 3530
6 TraesCS7D01G285400 chr4D 96.681 2109 53 11 1 2096 134962052 134964156 0.000000e+00 3491
7 TraesCS7D01G285400 chr7A 95.867 2105 74 6 1 2096 211365384 211363284 0.000000e+00 3393
8 TraesCS7D01G285400 chr7A 100.000 94 0 0 377 470 428334717 428334810 8.390000e-40 174
9 TraesCS7D01G285400 chr7A 98.333 60 1 0 40 99 70212485 70212544 3.100000e-19 106
10 TraesCS7D01G285400 chr1A 95.772 2105 74 9 3 2096 94579938 94582038 0.000000e+00 3380
11 TraesCS7D01G285400 chr1A 97.354 189 5 0 2097 2285 94730875 94730687 2.830000e-84 322
12 TraesCS7D01G285400 chr3D 97.757 1828 36 5 460 2285 602860678 602858854 0.000000e+00 3144
13 TraesCS7D01G285400 chr7B 98.315 653 10 1 1 653 54050823 54050172 0.000000e+00 1144
14 TraesCS7D01G285400 chrUn 98.942 189 2 0 2097 2285 171012478 171012290 2.810000e-89 339
15 TraesCS7D01G285400 chrUn 98.413 189 3 0 2097 2285 393029843 393029655 1.310000e-87 333
16 TraesCS7D01G285400 chr5B 97.884 189 4 0 2097 2285 567284189 567284001 6.090000e-86 327
17 TraesCS7D01G285400 chr1B 97.884 189 4 0 2097 2285 672545468 672545280 6.090000e-86 327
18 TraesCS7D01G285400 chr4B 97.354 189 5 0 2097 2285 495572141 495571953 2.830000e-84 322


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G285400 chr7D 307031323 307033607 2284 True 4220 4220 100.000 1 2285 1 chr7D.!!$R1 2284
1 TraesCS7D01G285400 chr7D 307161963 307164242 2279 False 3866 3866 97.244 1 2285 1 chr7D.!!$F1 2284
2 TraesCS7D01G285400 chr7D 382088841 382090942 2101 False 3600 3600 97.624 1 2096 1 chr7D.!!$F2 2095
3 TraesCS7D01G285400 chr7D 626710052 626712154 2102 True 3567 3567 97.340 1 2096 1 chr7D.!!$R2 2095
4 TraesCS7D01G285400 chr1D 275785261 275787544 2283 True 3925 3925 97.684 1 2285 1 chr1D.!!$R1 2284
5 TraesCS7D01G285400 chr4D 123400560 123402659 2099 False 3530 3530 97.055 2 2096 1 chr4D.!!$F1 2094
6 TraesCS7D01G285400 chr4D 134962052 134964156 2104 False 3491 3491 96.681 1 2096 1 chr4D.!!$F2 2095
7 TraesCS7D01G285400 chr7A 211363284 211365384 2100 True 3393 3393 95.867 1 2096 1 chr7A.!!$R1 2095
8 TraesCS7D01G285400 chr1A 94579938 94582038 2100 False 3380 3380 95.772 3 2096 1 chr1A.!!$F1 2093
9 TraesCS7D01G285400 chr3D 602858854 602860678 1824 True 3144 3144 97.757 460 2285 1 chr3D.!!$R1 1825
10 TraesCS7D01G285400 chr7B 54050172 54050823 651 True 1144 1144 98.315 1 653 1 chr7B.!!$R1 652

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
196 198 1.421646 ACCCTTTGACTCTTCCACTGG 59.578 52.381 0.0 0.0 0.0 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1611 1626 2.437651 AGGAGAAGCTTCTTCTATGGCC 59.562 50.0 32.11 23.67 41.36 5.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
107 108 2.434702 GGGTAGCCTAGTGTGTAAGCAT 59.565 50.000 2.95 0.00 0.00 3.79
196 198 1.421646 ACCCTTTGACTCTTCCACTGG 59.578 52.381 0.00 0.00 0.00 4.00
1157 1171 3.215151 TCGACTTCTCCGCTATGATCTT 58.785 45.455 0.00 0.00 0.00 2.40
1252 1266 5.103000 CGGAGATTCACGAAGAAGTATTGT 58.897 41.667 0.00 0.00 40.15 2.71
1611 1626 4.098501 GGACTATTTCTCCTTTTGGCCATG 59.901 45.833 6.09 0.00 40.12 3.66
1821 1836 2.344142 GCGAACATGTTTAAATTGCCCG 59.656 45.455 13.36 9.17 0.00 6.13
1966 1987 9.045745 AGCATTTTCTTTCCTATGGGATAAAAA 57.954 29.630 13.72 12.96 41.87 1.94
2087 2111 1.139853 GAGTGGGTATGAGGGCTTCTG 59.860 57.143 0.00 0.00 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
107 108 3.192230 CGCCGCGGTTCATTGCTA 61.192 61.111 28.70 0.00 0.00 3.49
196 198 8.969267 GTATGAGCATTCGGTACATATATAAGC 58.031 37.037 0.00 0.00 0.00 3.09
321 326 3.981211 TCTTGTAACCGTCACCTGTAAC 58.019 45.455 0.00 0.00 0.00 2.50
510 515 0.933796 GCAATAGCAGCTCCGAGAAC 59.066 55.000 0.00 0.00 41.58 3.01
680 691 1.271054 CGGAATAGGAGGAAGCCATGG 60.271 57.143 7.63 7.63 0.00 3.66
776 787 1.078143 ATCAGAGGTTCGGCTTGCC 60.078 57.895 0.75 0.75 0.00 4.52
1157 1171 5.340891 AGCTCCTATATGAACTACTGGGA 57.659 43.478 0.00 0.00 0.00 4.37
1586 1601 4.538490 TGGCCAAAAGGAGAAATAGTCCTA 59.462 41.667 0.61 0.00 44.17 2.94
1611 1626 2.437651 AGGAGAAGCTTCTTCTATGGCC 59.562 50.000 32.11 23.67 41.36 5.36
1966 1987 7.233348 ACCACTCAATAGTTCCAATTCATTGTT 59.767 33.333 0.00 0.00 32.88 2.83
2202 2226 1.134670 GCACTAAGACTGCCTCGGAAT 60.135 52.381 0.00 0.00 0.00 3.01
2204 2228 0.612174 AGCACTAAGACTGCCTCGGA 60.612 55.000 0.00 0.00 35.01 4.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.