Multiple sequence alignment - TraesCS7D01G283300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G283300 chr7D 100.000 3961 0 0 1 3961 292322575 292326535 0.000000e+00 7315.0
1 TraesCS7D01G283300 chr7D 99.017 3968 32 4 1 3961 83434449 83438416 0.000000e+00 7105.0
2 TraesCS7D01G283300 chrUn 98.841 3968 33 8 1 3961 19136311 19140272 0.000000e+00 7060.0
3 TraesCS7D01G283300 chr4D 98.765 3968 35 10 1 3961 215025811 215021851 0.000000e+00 7044.0
4 TraesCS7D01G283300 chr2D 98.740 3968 42 5 1 3961 142215986 142219952 0.000000e+00 7044.0
5 TraesCS7D01G283300 chr2D 94.856 2216 103 8 340 2548 89876608 89874397 0.000000e+00 3450.0
6 TraesCS7D01G283300 chr2D 98.364 978 11 3 2987 3961 203130316 203131291 0.000000e+00 1712.0
7 TraesCS7D01G283300 chr2D 91.709 784 57 5 2601 3378 557103465 557104246 0.000000e+00 1081.0
8 TraesCS7D01G283300 chr5A 97.663 2953 65 3 26 2976 427854208 427851258 0.000000e+00 5068.0
9 TraesCS7D01G283300 chr5A 96.541 318 11 0 26 343 65997464 65997781 9.750000e-146 527.0
10 TraesCS7D01G283300 chr5A 100.000 28 0 0 1 28 427854247 427854220 7.000000e-03 52.8
11 TraesCS7D01G283300 chr6A 97.596 2954 66 4 26 2976 517540448 517537497 0.000000e+00 5057.0
12 TraesCS7D01G283300 chr6A 100.000 28 0 0 1 28 517540487 517540460 7.000000e-03 52.8
13 TraesCS7D01G283300 chr1D 97.144 2661 31 14 1316 3961 460574411 460571781 0.000000e+00 4451.0
14 TraesCS7D01G283300 chr1D 94.570 755 32 7 2629 3378 455913121 455913871 0.000000e+00 1158.0
15 TraesCS7D01G283300 chr1D 93.782 595 25 7 3360 3944 455913811 455914403 0.000000e+00 883.0
16 TraesCS7D01G283300 chr1D 98.765 324 4 0 1 324 460574734 460574411 9.540000e-161 577.0
17 TraesCS7D01G283300 chr2A 95.135 2220 95 6 340 2551 89491533 89489319 0.000000e+00 3489.0
18 TraesCS7D01G283300 chr2A 95.343 1503 52 7 2463 3961 27766309 27764821 0.000000e+00 2372.0
19 TraesCS7D01G283300 chr2B 94.004 2218 119 7 340 2548 142377787 142375575 0.000000e+00 3347.0
20 TraesCS7D01G283300 chr3D 93.434 594 29 8 3360 3944 48645316 48645908 0.000000e+00 872.0
21 TraesCS7D01G283300 chr3D 94.231 572 23 5 3382 3944 534050745 534050175 0.000000e+00 865.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G283300 chr7D 292322575 292326535 3960 False 7315.0 7315 100.0000 1 3961 1 chr7D.!!$F2 3960
1 TraesCS7D01G283300 chr7D 83434449 83438416 3967 False 7105.0 7105 99.0170 1 3961 1 chr7D.!!$F1 3960
2 TraesCS7D01G283300 chrUn 19136311 19140272 3961 False 7060.0 7060 98.8410 1 3961 1 chrUn.!!$F1 3960
3 TraesCS7D01G283300 chr4D 215021851 215025811 3960 True 7044.0 7044 98.7650 1 3961 1 chr4D.!!$R1 3960
4 TraesCS7D01G283300 chr2D 142215986 142219952 3966 False 7044.0 7044 98.7400 1 3961 1 chr2D.!!$F1 3960
5 TraesCS7D01G283300 chr2D 89874397 89876608 2211 True 3450.0 3450 94.8560 340 2548 1 chr2D.!!$R1 2208
6 TraesCS7D01G283300 chr2D 203130316 203131291 975 False 1712.0 1712 98.3640 2987 3961 1 chr2D.!!$F2 974
7 TraesCS7D01G283300 chr2D 557103465 557104246 781 False 1081.0 1081 91.7090 2601 3378 1 chr2D.!!$F3 777
8 TraesCS7D01G283300 chr5A 427851258 427854247 2989 True 2560.4 5068 98.8315 1 2976 2 chr5A.!!$R1 2975
9 TraesCS7D01G283300 chr6A 517537497 517540487 2990 True 2554.9 5057 98.7980 1 2976 2 chr6A.!!$R1 2975
10 TraesCS7D01G283300 chr1D 460571781 460574734 2953 True 2514.0 4451 97.9545 1 3961 2 chr1D.!!$R1 3960
11 TraesCS7D01G283300 chr1D 455913121 455914403 1282 False 1020.5 1158 94.1760 2629 3944 2 chr1D.!!$F1 1315
12 TraesCS7D01G283300 chr2A 89489319 89491533 2214 True 3489.0 3489 95.1350 340 2551 1 chr2A.!!$R2 2211
13 TraesCS7D01G283300 chr2A 27764821 27766309 1488 True 2372.0 2372 95.3430 2463 3961 1 chr2A.!!$R1 1498
14 TraesCS7D01G283300 chr2B 142375575 142377787 2212 True 3347.0 3347 94.0040 340 2548 1 chr2B.!!$R1 2208
15 TraesCS7D01G283300 chr3D 48645316 48645908 592 False 872.0 872 93.4340 3360 3944 1 chr3D.!!$F1 584
16 TraesCS7D01G283300 chr3D 534050175 534050745 570 True 865.0 865 94.2310 3382 3944 1 chr3D.!!$R1 562

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
149 164 1.340017 CGGAAAGAGGATGGGAGCAAA 60.340 52.381 0.0 0.0 0.00 3.68 F
1328 1354 4.574674 AGGATTATTGTTCCTCAGTGCA 57.425 40.909 0.0 0.0 39.46 4.57 F
1544 1570 2.125773 ACCGAGGTCACGAGAATAGT 57.874 50.000 0.0 0.0 35.09 2.12 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1544 1570 3.197766 ACTCACCAGTTTCAGTGAAGTCA 59.802 43.478 5.56 0.0 42.19 3.41 R
2488 2530 5.408204 ACAAGCAAGCAATAAAAGCAAAC 57.592 34.783 0.00 0.0 0.00 2.93 R
3358 3408 6.668541 TCTGAAAAAGGAAAGATATCTGCG 57.331 37.500 5.86 0.0 0.00 5.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
85 100 6.916360 AGTTGGTGGTTGTATTGATGATTT 57.084 33.333 0.00 0.0 0.00 2.17
149 164 1.340017 CGGAAAGAGGATGGGAGCAAA 60.340 52.381 0.00 0.0 0.00 3.68
436 451 8.508875 TGTACGATCTTGCGATGATTATAACTA 58.491 33.333 0.00 0.0 34.83 2.24
1328 1354 4.574674 AGGATTATTGTTCCTCAGTGCA 57.425 40.909 0.00 0.0 39.46 4.57
1544 1570 2.125773 ACCGAGGTCACGAGAATAGT 57.874 50.000 0.00 0.0 35.09 2.12
1799 1825 3.321968 GCCTTTGTTGGGACTTCTGAAAT 59.678 43.478 0.00 0.0 0.00 2.17
2246 2282 5.127682 ACAGTTCACAAAGAATTGGAAAGCT 59.872 36.000 5.54 0.0 45.31 3.74
2393 2430 6.215636 ACAATTACTCCCCTTGACTTCTGTAT 59.784 38.462 0.00 0.0 0.00 2.29
2488 2530 2.089980 CAACAGATCTTCCTGCCCAAG 58.910 52.381 0.00 0.0 37.68 3.61
3403 3454 8.815912 TCAGATATGTACTTATGTATGGTGCAT 58.184 33.333 6.03 0.0 39.06 3.96
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 73 6.774673 TCATCAATACAACCACCAACTAAGA 58.225 36.000 0.00 0.00 0.00 2.10
85 100 1.992557 AGTCTGAACCATTAAGGGCCA 59.007 47.619 6.18 3.92 43.89 5.36
180 195 5.295292 AGCAACAACATTCCATAGAAGATCG 59.705 40.000 0.00 0.00 34.86 3.69
436 451 2.508300 ACTACCAACCCTCAAGTGTTGT 59.492 45.455 4.96 0.00 40.12 3.32
791 817 2.398588 TGTTCTGACCCTGTGTCTTCT 58.601 47.619 0.00 0.00 44.75 2.85
1544 1570 3.197766 ACTCACCAGTTTCAGTGAAGTCA 59.802 43.478 5.56 0.00 42.19 3.41
1748 1774 3.765511 TCAGCTTGGCTTGCTTAATCATT 59.234 39.130 2.30 0.00 36.40 2.57
2270 2306 6.489675 ACAGAAAACAAGATAATATGCTGCG 58.510 36.000 0.00 0.00 0.00 5.18
2393 2430 6.209788 ACCACTGGTTTTGAACAGAAAAACTA 59.790 34.615 10.55 5.09 43.73 2.24
2488 2530 5.408204 ACAAGCAAGCAATAAAAGCAAAC 57.592 34.783 0.00 0.00 0.00 2.93
2890 2932 7.245292 AGGCTAATAGTCTATTCTGGACATCT 58.755 38.462 8.41 0.00 36.29 2.90
3358 3408 6.668541 TCTGAAAAAGGAAAGATATCTGCG 57.331 37.500 5.86 0.00 0.00 5.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.