Multiple sequence alignment - TraesCS7D01G255000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G255000 chr7D 100.000 2307 0 0 1 2307 231555878 231553572 0.000000e+00 4261
1 TraesCS7D01G255000 chr6D 99.316 2047 13 1 262 2307 389247014 389244968 0.000000e+00 3701
2 TraesCS7D01G255000 chr6D 100.000 254 0 0 8 261 389254763 389255016 9.650000e-129 470
3 TraesCS7D01G255000 chr6D 99.606 254 1 0 8 261 389249968 389250221 4.490000e-127 464
4 TraesCS7D01G255000 chr7B 99.170 2047 16 1 262 2307 663100617 663098571 0.000000e+00 3685
5 TraesCS7D01G255000 chr7B 99.023 2047 19 1 262 2307 662725212 662727258 0.000000e+00 3668
6 TraesCS7D01G255000 chr7B 99.606 254 1 0 8 261 662723998 662724251 4.490000e-127 464
7 TraesCS7D01G255000 chr5D 99.170 2047 16 1 262 2307 503244080 503246126 0.000000e+00 3685
8 TraesCS7D01G255000 chr3D 99.169 2046 15 2 262 2307 589264715 589262672 0.000000e+00 3683
9 TraesCS7D01G255000 chr3D 100.000 252 0 0 10 261 427289860 427289609 1.250000e-127 466
10 TraesCS7D01G255000 chr3D 99.606 254 1 0 8 261 589265929 589265676 4.490000e-127 464
11 TraesCS7D01G255000 chr3A 99.120 2046 18 0 262 2307 66006324 66004279 0.000000e+00 3679
12 TraesCS7D01G255000 chr3A 99.606 254 1 0 8 261 66007538 66007285 4.490000e-127 464
13 TraesCS7D01G255000 chr2A 99.072 2047 18 1 262 2307 726907647 726905601 0.000000e+00 3674
14 TraesCS7D01G255000 chr2A 100.000 254 0 0 8 261 726897224 726897477 9.650000e-129 470
15 TraesCS7D01G255000 chr3B 98.730 2048 24 1 262 2307 201538329 201540376 0.000000e+00 3637
16 TraesCS7D01G255000 chr2B 98.340 2048 31 2 262 2307 474919738 474921784 0.000000e+00 3591
17 TraesCS7D01G255000 chr5B 99.606 254 1 0 8 261 487447161 487447414 4.490000e-127 464
18 TraesCS7D01G255000 chrUn 99.213 254 2 0 8 261 444108706 444108959 2.090000e-125 459


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G255000 chr7D 231553572 231555878 2306 True 4261.0 4261 100.0000 1 2307 1 chr7D.!!$R1 2306
1 TraesCS7D01G255000 chr6D 389244968 389247014 2046 True 3701.0 3701 99.3160 262 2307 1 chr6D.!!$R1 2045
2 TraesCS7D01G255000 chr7B 663098571 663100617 2046 True 3685.0 3685 99.1700 262 2307 1 chr7B.!!$R1 2045
3 TraesCS7D01G255000 chr7B 662723998 662727258 3260 False 2066.0 3668 99.3145 8 2307 2 chr7B.!!$F1 2299
4 TraesCS7D01G255000 chr5D 503244080 503246126 2046 False 3685.0 3685 99.1700 262 2307 1 chr5D.!!$F1 2045
5 TraesCS7D01G255000 chr3D 589262672 589265929 3257 True 2073.5 3683 99.3875 8 2307 2 chr3D.!!$R2 2299
6 TraesCS7D01G255000 chr3A 66004279 66007538 3259 True 2071.5 3679 99.3630 8 2307 2 chr3A.!!$R1 2299
7 TraesCS7D01G255000 chr2A 726905601 726907647 2046 True 3674.0 3674 99.0720 262 2307 1 chr2A.!!$R1 2045
8 TraesCS7D01G255000 chr3B 201538329 201540376 2047 False 3637.0 3637 98.7300 262 2307 1 chr3B.!!$F1 2045
9 TraesCS7D01G255000 chr2B 474919738 474921784 2046 False 3591.0 3591 98.3400 262 2307 1 chr2B.!!$F1 2045

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
884 1845 1.254026 TTAGCTCAGTGGTACAGCGT 58.746 50.0 0.0 0.0 41.8 5.07 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1904 2868 1.164041 AAAAGTGAGCCACCGGTTCG 61.164 55.0 2.97 0.0 35.65 3.95 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
430 1391 2.860009 CCCGTCACACTATAGGAGCTA 58.140 52.381 4.43 0.00 0.00 3.32
879 1840 2.288273 CGGGCTATTAGCTCAGTGGTAC 60.288 54.545 15.64 0.00 43.44 3.34
884 1845 1.254026 TTAGCTCAGTGGTACAGCGT 58.746 50.000 0.00 0.00 41.80 5.07
1037 1998 5.221048 CCTGTTTGAATCGGAGTTTGAAACT 60.221 40.000 10.82 10.82 46.38 2.66
1428 2392 6.972328 TCAGGAAGAACGTGAAATTCTTTTTG 59.028 34.615 1.24 3.96 44.53 2.44
1660 2624 6.610020 TCCCGAAAAGGAGTCTATTGATTCTA 59.390 38.462 0.23 0.00 45.00 2.10
1904 2868 6.098017 GCGGTAATGATAGTATCTTGTACCC 58.902 44.000 20.34 14.21 0.00 3.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.036958 TCATAGTTGCATTGTCCCCG 57.963 50.000 0.00 0.0 0.00 5.73
1 2 4.210331 AGATTCATAGTTGCATTGTCCCC 58.790 43.478 0.00 0.0 0.00 4.81
2 3 4.883585 TGAGATTCATAGTTGCATTGTCCC 59.116 41.667 0.00 0.0 0.00 4.46
3 4 6.436261 CATGAGATTCATAGTTGCATTGTCC 58.564 40.000 0.00 0.0 34.28 4.02
4 5 6.261603 TCCATGAGATTCATAGTTGCATTGTC 59.738 38.462 0.00 0.0 34.28 3.18
5 6 6.124340 TCCATGAGATTCATAGTTGCATTGT 58.876 36.000 0.00 0.0 34.28 2.71
6 7 6.485648 TCTCCATGAGATTCATAGTTGCATTG 59.514 38.462 0.00 0.0 34.28 2.82
350 1311 0.384669 GCTGACCGGCGATTACTAGT 59.615 55.000 9.30 0.0 0.00 2.57
430 1391 3.763897 GGGTAATGACTTCAAACATGGCT 59.236 43.478 0.00 0.0 0.00 4.75
884 1845 0.813610 CGACGCAATTATCAGGGGCA 60.814 55.000 0.00 0.0 0.00 5.36
1428 2392 1.674962 CTGCTCTGCTCCCATTTAAGC 59.325 52.381 0.00 0.0 39.02 3.09
1904 2868 1.164041 AAAAGTGAGCCACCGGTTCG 61.164 55.000 2.97 0.0 35.65 3.95


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.