Multiple sequence alignment - TraesCS7D01G244900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G244900 chr7D 100.000 2333 0 0 1 2333 213609596 213607264 0.000000e+00 4309
1 TraesCS7D01G244900 chr6B 94.051 2370 95 15 1 2333 460300401 460298041 0.000000e+00 3554
2 TraesCS7D01G244900 chr6B 95.109 1513 42 10 1 1485 281828593 281827085 0.000000e+00 2355
3 TraesCS7D01G244900 chr6B 85.512 1270 126 28 1 1236 327557450 327558695 0.000000e+00 1273
4 TraesCS7D01G244900 chr6B 92.532 857 31 15 1485 2333 281827059 281826228 0.000000e+00 1197
5 TraesCS7D01G244900 chr6B 82.872 1121 108 39 1266 2333 327558695 327559784 0.000000e+00 929
6 TraesCS7D01G244900 chr3B 95.087 1486 64 5 4 1483 257549135 257547653 0.000000e+00 2331
7 TraesCS7D01G244900 chr3B 94.885 782 36 3 1552 2333 257538475 257537698 0.000000e+00 1219
8 TraesCS7D01G244900 chr3B 95.890 73 3 0 1485 1557 257547625 257547553 4.070000e-23 119
9 TraesCS7D01G244900 chr6A 92.051 1497 90 11 3 1485 39927647 39926166 0.000000e+00 2078
10 TraesCS7D01G244900 chr6A 90.838 513 31 6 1485 1996 39926126 39925629 0.000000e+00 673
11 TraesCS7D01G244900 chr6A 93.333 150 3 4 2191 2333 39925404 39925255 5.050000e-52 215
12 TraesCS7D01G244900 chr4B 85.826 1411 136 30 1 1390 300483884 300482517 0.000000e+00 1439
13 TraesCS7D01G244900 chr4B 80.867 784 102 30 1578 2333 300482336 300481573 7.230000e-160 573
14 TraesCS7D01G244900 chr4A 90.688 945 70 7 30 959 228656689 228657630 0.000000e+00 1242
15 TraesCS7D01G244900 chr4A 87.591 822 57 16 1485 2293 228658242 228659031 0.000000e+00 911
16 TraesCS7D01G244900 chr4A 84.121 825 90 17 1 803 334265545 334266350 0.000000e+00 760
17 TraesCS7D01G244900 chr4A 92.287 363 25 2 1125 1485 228657844 228658205 1.600000e-141 512
18 TraesCS7D01G244900 chr4A 87.104 442 42 5 800 1236 334267177 334267608 9.690000e-134 486
19 TraesCS7D01G244900 chr4A 96.721 61 1 1 2274 2333 228659068 228659128 1.480000e-17 100
20 TraesCS7D01G244900 chr4D 91.285 918 66 6 575 1485 239764364 239765274 0.000000e+00 1240
21 TraesCS7D01G244900 chr4D 89.364 865 55 16 1485 2333 239765314 239766157 0.000000e+00 1053
22 TraesCS7D01G244900 chr4D 89.723 506 42 3 3 502 239763860 239764361 2.530000e-179 638
23 TraesCS7D01G244900 chr4D 89.247 372 21 9 1975 2333 58930453 58930088 4.570000e-122 448
24 TraesCS7D01G244900 chr1D 78.784 740 115 25 1626 2333 125788130 125788859 2.110000e-125 459
25 TraesCS7D01G244900 chr2D 82.218 523 77 11 922 1440 413281278 413280768 9.900000e-119 436
26 TraesCS7D01G244900 chr3D 78.226 744 102 35 1626 2333 597050871 597050152 2.770000e-114 422
27 TraesCS7D01G244900 chr7B 81.818 517 70 16 932 1440 192739913 192740413 1.670000e-111 412
28 TraesCS7D01G244900 chr7A 80.179 560 95 9 885 1440 399875585 399875038 2.790000e-109 405
29 TraesCS7D01G244900 chr5B 90.625 128 12 0 461 588 330122381 330122508 1.110000e-38 171
30 TraesCS7D01G244900 chr5B 89.844 128 13 0 461 588 330431937 330432064 5.160000e-37 165


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G244900 chr7D 213607264 213609596 2332 True 4309.000000 4309 100.00000 1 2333 1 chr7D.!!$R1 2332
1 TraesCS7D01G244900 chr6B 460298041 460300401 2360 True 3554.000000 3554 94.05100 1 2333 1 chr6B.!!$R1 2332
2 TraesCS7D01G244900 chr6B 281826228 281828593 2365 True 1776.000000 2355 93.82050 1 2333 2 chr6B.!!$R2 2332
3 TraesCS7D01G244900 chr6B 327557450 327559784 2334 False 1101.000000 1273 84.19200 1 2333 2 chr6B.!!$F1 2332
4 TraesCS7D01G244900 chr3B 257547553 257549135 1582 True 1225.000000 2331 95.48850 4 1557 2 chr3B.!!$R2 1553
5 TraesCS7D01G244900 chr3B 257537698 257538475 777 True 1219.000000 1219 94.88500 1552 2333 1 chr3B.!!$R1 781
6 TraesCS7D01G244900 chr6A 39925255 39927647 2392 True 988.666667 2078 92.07400 3 2333 3 chr6A.!!$R1 2330
7 TraesCS7D01G244900 chr4B 300481573 300483884 2311 True 1006.000000 1439 83.34650 1 2333 2 chr4B.!!$R1 2332
8 TraesCS7D01G244900 chr4A 228656689 228659128 2439 False 691.250000 1242 91.82175 30 2333 4 chr4A.!!$F1 2303
9 TraesCS7D01G244900 chr4A 334265545 334267608 2063 False 623.000000 760 85.61250 1 1236 2 chr4A.!!$F2 1235
10 TraesCS7D01G244900 chr4D 239763860 239766157 2297 False 977.000000 1240 90.12400 3 2333 3 chr4D.!!$F1 2330
11 TraesCS7D01G244900 chr1D 125788130 125788859 729 False 459.000000 459 78.78400 1626 2333 1 chr1D.!!$F1 707
12 TraesCS7D01G244900 chr2D 413280768 413281278 510 True 436.000000 436 82.21800 922 1440 1 chr2D.!!$R1 518
13 TraesCS7D01G244900 chr3D 597050152 597050871 719 True 422.000000 422 78.22600 1626 2333 1 chr3D.!!$R1 707
14 TraesCS7D01G244900 chr7B 192739913 192740413 500 False 412.000000 412 81.81800 932 1440 1 chr7B.!!$F1 508
15 TraesCS7D01G244900 chr7A 399875038 399875585 547 True 405.000000 405 80.17900 885 1440 1 chr7A.!!$R1 555

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
907 1790 1.089481 TTCCTGATTCACGCGCATCC 61.089 55.0 5.73 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2052 3280 3.885297 ACAACCATCAGCTTGCATATACC 59.115 43.478 0.0 0.0 0.0 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
373 398 5.596836 TGCCCTTTTTCATGGACATTATC 57.403 39.130 0.00 0.00 0.00 1.75
395 420 3.151554 TGCAATTGATGTGAGTCTTGCT 58.848 40.909 10.34 0.00 39.64 3.91
633 679 8.367911 TCTGAGTGTAAACTGTATTGAGTGAAT 58.632 33.333 0.00 0.00 0.00 2.57
636 682 8.311650 AGTGTAAACTGTATTGAGTGAATCAC 57.688 34.615 5.02 5.02 37.77 3.06
767 817 4.079850 CAGCCTCGCCTGCTCAGT 62.080 66.667 0.00 0.00 36.81 3.41
803 1684 4.573900 CTCTGCCACAGAAACACTCTAAT 58.426 43.478 0.00 0.00 40.18 1.73
907 1790 1.089481 TTCCTGATTCACGCGCATCC 61.089 55.000 5.73 0.00 0.00 3.51
1050 2021 9.661187 GTTGATGAACATGTCAATAAGATCATC 57.339 33.333 19.19 19.19 40.50 2.92
1081 2052 9.921637 TGAAAAATAAGGTATTTTGCTTAGTGG 57.078 29.630 11.12 0.00 44.98 4.00
1493 2562 7.148171 GCAGGCTCATCTTTCCCATATAATTAC 60.148 40.741 0.00 0.00 0.00 1.89
1505 2576 7.794041 TCCCATATAATTACGGTACACTTGTT 58.206 34.615 0.00 0.00 0.00 2.83
1610 2689 0.320073 TCGTAGTTTTCCTGCACCCG 60.320 55.000 0.00 0.00 0.00 5.28
1612 2691 1.302993 TAGTTTTCCTGCACCCGCC 60.303 57.895 0.00 0.00 37.32 6.13
1613 2692 2.058125 TAGTTTTCCTGCACCCGCCA 62.058 55.000 0.00 0.00 37.32 5.69
1614 2693 2.909965 TTTTCCTGCACCCGCCAC 60.910 61.111 0.00 0.00 37.32 5.01
2103 3331 2.592102 ACAGCCACATCTGATTGGTT 57.408 45.000 15.48 9.91 37.51 3.67
2111 3339 4.158394 CCACATCTGATTGGTTAAAGGTGG 59.842 45.833 0.00 0.00 36.49 4.61
2167 3402 6.293790 CCATCGATATTCAGAACATGTGCAAT 60.294 38.462 6.60 0.48 0.00 3.56
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
373 398 3.190744 AGCAAGACTCACATCAATTGCAG 59.809 43.478 10.00 0.00 44.11 4.41
633 679 7.171508 GTCAGATTGTTCTCATGTTAACAGTGA 59.828 37.037 14.65 15.11 36.96 3.41
636 682 7.516481 CAGTCAGATTGTTCTCATGTTAACAG 58.484 38.462 14.65 6.58 36.96 3.16
767 817 4.824537 TGTGGCAGAGCTACAAACAAATAA 59.175 37.500 5.70 0.00 46.28 1.40
907 1790 6.003950 TGTCAATTAAACTCTCCCCTTCAAG 58.996 40.000 0.00 0.00 0.00 3.02
1050 2021 8.742554 AGCAAAATACCTTATTTTTCAGTTCG 57.257 30.769 1.89 0.00 43.71 3.95
1505 2576 8.901472 AGGGATGCATGATCTAAGTAGTATAA 57.099 34.615 2.46 0.00 0.00 0.98
2052 3280 3.885297 ACAACCATCAGCTTGCATATACC 59.115 43.478 0.00 0.00 0.00 2.73
2103 3331 8.268605 TGCATATTAATACACAGACCACCTTTA 58.731 33.333 0.00 0.00 0.00 1.85
2111 3339 7.721286 AGAAGCTGCATATTAATACACAGAC 57.279 36.000 22.11 15.64 0.00 3.51
2188 3425 5.773176 CACCCATTCTTTGTAAACTAAGGGT 59.227 40.000 0.00 0.00 31.26 4.34
2193 3430 7.514721 AGTCTTCACCCATTCTTTGTAAACTA 58.485 34.615 0.00 0.00 0.00 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.