Multiple sequence alignment - TraesCS7D01G239300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7D01G239300 chr7D 100.000 2513 0 0 1 2513 203995226 203997738 0.000000e+00 4641
1 TraesCS7D01G239300 chr6D 97.053 2545 37 11 1 2513 428627490 428624952 0.000000e+00 4250
2 TraesCS7D01G239300 chr3B 93.892 2554 79 22 1 2513 730751447 730753964 0.000000e+00 3781
3 TraesCS7D01G239300 chr2A 93.520 2068 96 23 455 2513 706865254 706867292 0.000000e+00 3042
4 TraesCS7D01G239300 chr2A 83.333 162 27 0 1399 1560 553080000 553080161 1.560000e-32 150
5 TraesCS7D01G239300 chr7A 92.956 2087 90 24 455 2513 22285598 22287655 0.000000e+00 2987
6 TraesCS7D01G239300 chr7A 92.234 2099 101 28 444 2513 660323642 660321577 0.000000e+00 2916
7 TraesCS7D01G239300 chr3A 92.525 2087 100 22 455 2513 433295846 433297904 0.000000e+00 2939
8 TraesCS7D01G239300 chr6B 97.367 1595 24 1 35 1611 583615756 583617350 0.000000e+00 2697
9 TraesCS7D01G239300 chr6B 98.895 543 5 1 1971 2513 672286569 672286028 0.000000e+00 968
10 TraesCS7D01G239300 chr6B 92.911 663 27 6 1 655 672287222 672286572 0.000000e+00 946
11 TraesCS7D01G239300 chr6B 99.248 399 3 0 2115 2513 583619612 583620010 0.000000e+00 721
12 TraesCS7D01G239300 chr4D 97.743 842 17 2 1 842 36489629 36488790 0.000000e+00 1448
13 TraesCS7D01G239300 chr5D 82.692 728 75 27 183 876 432596057 432596767 1.290000e-167 599
14 TraesCS7D01G239300 chr4B 79.973 744 137 11 1776 2513 497375779 497375042 2.840000e-149 538
15 TraesCS7D01G239300 chr2D 95.513 156 7 0 1 156 142002972 142002817 1.490000e-62 250


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7D01G239300 chr7D 203995226 203997738 2512 False 4641 4641 100.0000 1 2513 1 chr7D.!!$F1 2512
1 TraesCS7D01G239300 chr6D 428624952 428627490 2538 True 4250 4250 97.0530 1 2513 1 chr6D.!!$R1 2512
2 TraesCS7D01G239300 chr3B 730751447 730753964 2517 False 3781 3781 93.8920 1 2513 1 chr3B.!!$F1 2512
3 TraesCS7D01G239300 chr2A 706865254 706867292 2038 False 3042 3042 93.5200 455 2513 1 chr2A.!!$F2 2058
4 TraesCS7D01G239300 chr7A 22285598 22287655 2057 False 2987 2987 92.9560 455 2513 1 chr7A.!!$F1 2058
5 TraesCS7D01G239300 chr7A 660321577 660323642 2065 True 2916 2916 92.2340 444 2513 1 chr7A.!!$R1 2069
6 TraesCS7D01G239300 chr3A 433295846 433297904 2058 False 2939 2939 92.5250 455 2513 1 chr3A.!!$F1 2058
7 TraesCS7D01G239300 chr6B 583615756 583620010 4254 False 1709 2697 98.3075 35 2513 2 chr6B.!!$F1 2478
8 TraesCS7D01G239300 chr6B 672286028 672287222 1194 True 957 968 95.9030 1 2513 2 chr6B.!!$R1 2512
9 TraesCS7D01G239300 chr4D 36488790 36489629 839 True 1448 1448 97.7430 1 842 1 chr4D.!!$R1 841
10 TraesCS7D01G239300 chr5D 432596057 432596767 710 False 599 599 82.6920 183 876 1 chr5D.!!$F1 693
11 TraesCS7D01G239300 chr4B 497375042 497375779 737 True 538 538 79.9730 1776 2513 1 chr4B.!!$R1 737

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
212 213 1.236628 CGACCACCTCTCCCTATACG 58.763 60.000 0.0 0.0 0.00 3.06 F
809 885 4.764050 TGGGACTTTGTTCTCAACACTA 57.236 40.909 0.0 0.0 41.97 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1478 1602 3.85595 CGTCATGGTAAACTTCCTACGAC 59.144 47.826 0.0 0.0 32.54 4.34 R
1910 2052 7.86582 TCCAAATCCTGTCAAGATAGATTTCT 58.134 34.615 0.0 0.0 0.00 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
61 62 2.201210 CCCTGCCCACCCTGTTTT 59.799 61.111 0.00 0.0 0.00 2.43
105 106 3.918220 CCGCGATTCGAGCACTGC 61.918 66.667 8.23 0.0 41.67 4.40
212 213 1.236628 CGACCACCTCTCCCTATACG 58.763 60.000 0.00 0.0 0.00 3.06
262 263 7.402054 ACATGGTGATTAGTTGTAGGATTTGA 58.598 34.615 0.00 0.0 0.00 2.69
467 541 9.938280 TTTTGCTAGTACATACTTAATGACAGT 57.062 29.630 0.00 0.0 39.07 3.55
809 885 4.764050 TGGGACTTTGTTCTCAACACTA 57.236 40.909 0.00 0.0 41.97 2.74
1221 1345 5.221682 TGGAAAAACCATTGATGACAAGCAT 60.222 36.000 0.00 0.0 44.64 3.79
1478 1602 1.511887 CCGCACGAAAAGATTGGCG 60.512 57.895 0.00 0.0 43.68 5.69
1492 1616 3.194116 AGATTGGCGTCGTAGGAAGTTTA 59.806 43.478 0.00 0.0 0.00 2.01
1773 1903 4.114794 TGATTCTGTATGTGCAGATGTCG 58.885 43.478 6.60 0.0 43.99 4.35
1782 1924 1.657594 GTGCAGATGTCGTGTGATGAG 59.342 52.381 0.00 0.0 0.00 2.90
1783 1925 1.545582 TGCAGATGTCGTGTGATGAGA 59.454 47.619 0.00 0.0 0.00 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
10 11 3.094062 GCTGATGGCGGCAGACCTA 62.094 63.158 19.29 0.52 45.91 3.08
212 213 2.557924 TCACAAATTCCACCATGAGCAC 59.442 45.455 0.00 0.00 0.00 4.40
809 885 5.014123 TCCACCACTCCTTATCTTGTTTGAT 59.986 40.000 0.00 0.00 0.00 2.57
1221 1345 4.347000 ACTTGTGCAGTCCTAGGTTTCTTA 59.653 41.667 9.08 0.00 0.00 2.10
1478 1602 3.855950 CGTCATGGTAAACTTCCTACGAC 59.144 47.826 0.00 0.00 32.54 4.34
1773 1903 9.643693 AATTCATATTGGTTTTTCTCATCACAC 57.356 29.630 0.00 0.00 0.00 3.82
1910 2052 7.865820 TCCAAATCCTGTCAAGATAGATTTCT 58.134 34.615 0.00 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.